Genome Analysis Toolkit

Variant Discovery in High-Throughput Sequencing Data

GATK process banner

Need Help?

Search our documentation

Community Forum

Hi, How can we help?

Developed in the Data Sciences Platform at the Broad Institute, the toolkit offers a wide variety of tools with a primary focus on variant discovery and genotyping. Its powerful processing engine and high-performance computing features make it capable of taking on projects of any size. Learn more

FastaAlternateReferenceMaker Follow

1 comment

  • Avatar
    Baoxing Song
    Chr1 1 Chr1_1 C GTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTTAGGTTTTAGGGTTCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAAACCCTTAAACCCTAAACCCTAAACCCTAAATAAAGCGCTGTGGGATCAATCATTGCATTTTTCCATAGGATAGATAGGGCCGACAAGATCATCAGGGAAGAAGTCAAATCACATCCGAATTCAATTGTTCTTTTCCTAAACCCTAAACCCTAAACACTAAAC 50 PASS DP=1 GT:GQ:DP 1|1:50:1

    I am working on a vcf file shared by my college. There is an insertion at the very beginning of Chr1 (see above), and the FastaAlternateReferenceMaker function ignored the first variant record.

    0
    Comment actions Permalink

Please sign in to leave a comment.

Powered by Zendesk