Call somatic SNVs and indels via local assembly of haplotypes
Category Short Variant Discovery
Overview
Call somatic short variants via local assembly of haplotypes. Short variants include single nucleotide (SNV) and insertion and deletion (indel) variants. The caller combines the DREAM challenge-winning somatic genotyping engine of the original MuTect (Cibulskis et al., 2013) with the assembly-based machinery of HaplotypeCaller.
This tool is featured in the Somatic Short Mutation calling Best Practice Workflow. See Tutorial#11136 for a step-by-step description of the workflow and Article#11127 for an overview of what traditional somatic calling entails. For the latest pipeline scripts, see the Mutect2 WDL scripts directory. Although we present the tool for somatic calling, it may apply to other contexts, such as mitochondrial variant calling.
Usage examples
Example commands show how to run Mutect2 for typical scenarios. The two modes are (i) somatic mode where a tumor sample is matched with a normal sample in analysis and (ii) tumor-only mode where a single sample's alignment data undergoes analysis.
(i) Tumor with matched normal
Given a matched normal, Mutect2 is designed to call somatic variants only. The tool includes logic to skip emitting variants that are clearly present in the germline based on provided evidence, e.g. in the matched normal. This is done at an early stage to avoid spending computational resources on germline events. If the variant's germline status is borderline, then Mutect2 will emit the variant to the callset for subsequent filtering and review.
gatk Mutect2 \ -R reference.fa \ -I tumor.bam \ -tumor tumor_sample_name \ -I normal.bam \ -normal normal_sample_name \ --germline-resource af-only-gnomad.vcf.gz \ --af-of-alleles-not-in-resource 0.00003125 \ --panel-of-normals pon.vcf.gz \ -O somatic.vcf.gz
The --af-of-alleles-not-in-resource argument value should match expectations for alleles not found in the provided germline resource. Note the tool does not require a germline resource nor a panel of normals (PoN) to run. The tool prefilters sites for the matched normal and the PoN. For the germline resource, the tool prefilters on the allele. Below is an excerpt of a known variants resource with population allele frequencies
#CHROM POS ID REF ALT QUAL FILTER INFO
1 10067 . T TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC 30.35 PASS AC=3;AF=7.384E-5
1 10108 . CAACCCT C 46514.32 PASS AC=6;AF=1.525E-4
1 10109 . AACCCTAACCCT AAACCCT,* 89837.27 PASS AC=48,5;AF=0.001223,1.273E-4
1 10114 . TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCTAACCCTAACCCTAACCCTAACCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCTAACCCTAAACCCTA *,CAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCTAACCCTAACCCTAACCCTAACCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCTAACCCTAAACCCTA,T 36728.97 PASS AC=55,9,1;AF=0.001373,2.246E-4,2.496E-5
1 10119 . CT C,* 251.23 PASS AC=5,1;AF=1.249E-4,2.498E-5
1 10120 . TA CA,* 14928.74 PASS AC=10,6;AF=2.5E-4,1.5E-4
1 10128 . ACCCTAACCCTAACCCTAAC A,* 285.71 PASS AC=3,1;AF=7.58E-5,2.527E-5
1 10131 . CT C,* 378.93 PASS AC=7,5;AF=1.765E-4,1.261E-4
1 10132 . TAACCC *,T 18025.11 PASS AC=12,2;AF=3.03E-4,5.049E-5
(ii) Tumor-only mode
This mode runs on a single sample, e.g. single tumor or single normal sample. To create a PoN, call on each normal sample in this mode, then use CreateSomaticPanelOfNormals to generate the PoN.
gatk Mutect2 \ -R reference.fa \ -I sample.bam \ -tumor sample_name \ -O single_sample.vcf.gz
Further points of interest
Additional parameters that factor towards filtering, including normal-artifact-lod (default threshold 0.0) and tumor-lod (default threshold 5.3), are available in FilterMutectCalls. While the tool calculates normal-lod assuming a diploid genotype, it calculates normal-artifact-lod with the same approach it uses for tumor-lod, i.e. with a variable ploidy assumption.
- - If the normal artifact log odds becomes large, then FilterMutectCalls applies the artifact-in-normal filter. For matched normal samples with tumor contamination, consider increasing the normal-artifact-lod threshold.
- - The tumor log odds, which is calculated independently of any matched normal, determines whether to filter a tumor variant. Variants with tumor LODs exceeding the threshold pass filtering.
If a variant is absent from a given germline resource, then the value for --af-of-alleles-not-in-resource applies. For example, gnomAD's 16,000 samples (~32,000 homologs per locus) becomes a probability of one in 32,000 or less. Thus, an allele's absence from the germline resource becomes evidence that it is not a germline variant.
Caveats
Although GATK4 Mutect2 accomodates varying coverage depths, further optimization of parameters may improve calling for extreme high depths, e.g. 1000X.
Mutect2 specific arguments
This table summarizes the command-line arguments that are specific to this tool. For more details on each argument, see the list further down below the table or click on an argument name to jump directly to that entry in the list.
| Argument name(s) | Default value | Summary | |
|---|---|---|---|
| Required Arguments | |||
| --input -I |
[] | BAM/SAM/CRAM file containing reads | |
| --output -O |
null | File to which variants should be written | |
| --reference -R |
null | Reference sequence file | |
| Optional Tool Arguments | |||
| --activity-profile-out |
null | Output the raw activity profile results in IGV format | |
| --af-of-alleles-not-in-resource -default-af |
-1.0 | Population allele fraction assigned to alleles not found in germline resource. Please see docs/mutect/mutect2.pdf fora derivation of the default value. | |
| --alleles |
null | The set of alleles at which to genotype when --genotyping_mode is GENOTYPE_GIVEN_ALLELES | |
| --annotate-with-num-discovered-alleles |
false | If provided, we will annotate records with the number of alternate alleles that were discovered (but not necessarily genotyped) at a given site | |
| --annotation -A |
[] | One or more specific annotations to add to variant calls | |
| --annotation-group -G |
[] | One or more groups of annotations to apply to variant calls | |
| --annotations-to-exclude -AX |
[] | One or more specific annotations to exclude from variant calls | |
| --arguments_file |
[] | read one or more arguments files and add them to the command line | |
| --assembly-region-out |
null | Output the assembly region to this IGV formatted file | |
| --base-quality-score-threshold |
18 | Base qualities below this threshold will be reduced to the minimum (6) | |
| --cloud-index-prefetch-buffer -CIPB |
-1 | Size of the cloud-only prefetch buffer (in MB; 0 to disable). Defaults to cloudPrefetchBuffer if unset. | |
| --cloud-prefetch-buffer -CPB |
40 | Size of the cloud-only prefetch buffer (in MB; 0 to disable). | |
| --contamination-fraction-to-filter -contamination |
0.0 | Fraction of contamination in sequencing data (for all samples) to aggressively remove | |
| --correct-overlapping-quality |
false | Undocumented option | |
| --count-reads |
false | If true, strand-based annotations use the number of reads, not fragments | |
| --disable-bam-index-caching -DBIC |
false | If true, don't cache bam indexes, this will reduce memory requirements but may harm performance if many intervals are specified. Caching is automatically disabled if there are no intervals specified. | |
| --disable-sequence-dictionary-validation |
false | If specified, do not check the sequence dictionaries from our inputs for compatibility. Use at your own risk! | |
| --downsampling-stride -stride |
1 | Downsample a pool of reads starting within a range of one or more bases. | |
| --founder-id |
[] | Samples representing the population "founders" | |
| --gcs-max-retries -gcs-retries |
20 | If the GCS bucket channel errors out, how many times it will attempt to re-initiate the connection | |
| --gcs-project-for-requester-pays |
"" | Project to bill when accessing "requester pays" buckets. If unset, these buckets cannot be accessed. | |
| --genotype-germline-sites |
false | (EXPERIMENTAL) Call all apparent germline site even though they will ultimately be filtered. | |
| --genotype-pon-sites |
false | Call sites in the PoN even though they will ultimately be filtered. | |
| --genotyping-mode |
DISCOVERY | Specifies how to determine the alternate alleles to use for genotyping | |
| --germline-resource |
null | Population vcf of germline sequencing containing allele fractions. | |
| --graph-output -graph |
null | Write debug assembly graph information to this file | |
| --help -h |
false | display the help message | |
| --heterozygosity |
0.001 | Heterozygosity value used to compute prior likelihoods for any locus. See the GATKDocs for full details on the meaning of this population genetics concept | |
| --heterozygosity-stdev |
0.01 | Standard deviation of heterozygosity for SNP and indel calling. | |
| --ignore-itr-artifacts |
false | Turn off read transformer that clips artifacts associated with end repair insertions near inverted tandem repeats. | |
| --indel-heterozygosity |
1.25E-4 | Heterozygosity for indel calling. See the GATKDocs for heterozygosity for full details on the meaning of this population genetics concept | |
| --initial-pcr-qual |
40 | PCR error rate for overlapping fragments in isActive() | |
| --initial-tumor-lod -init-lod |
2.0 | LOD threshold to consider pileup active. | |
| --interval-merging-rule -imr |
ALL | Interval merging rule for abutting intervals | |
| --intervals -L |
[] | One or more genomic intervals over which to operate | |
| --max-population-af -max-af |
0.01 | Maximum population allele frequency in tumor-only mode. | |
| --max-reads-per-alignment-start |
50 | Maximum number of reads to retain per alignment start position. Reads above this threshold will be downsampled. Set to 0 to disable. | |
| --min-base-quality-score -mbq |
10 | Minimum base quality required to consider a base for calling | |
| --mitochondria-mode |
false | Mitochondria mode sets emission and initial LODs to 0. | |
| --native-pair-hmm-threads |
4 | How many threads should a native pairHMM implementation use | |
| --native-pair-hmm-use-double-precision |
false | use double precision in the native pairHmm. This is slower but matches the java implementation better | |
| --normal-lod |
2.2 | LOD threshold for calling normal variant non-germline. | |
| --normal-sample -normal |
null | BAM sample name of normal. May be URL-encoded as output by GetSampleName with -encode argument. | |
| --num-reference-samples-if-no-call |
0 | Number of hom-ref genotypes to infer at sites not present in a panel | |
| --orientation-bias-artifact-priors |
null | table of prior artifact probabilities for the read orientation filter model | |
| --output-mode |
EMIT_VARIANTS_ONLY | Specifies which type of calls we should output | |
| --panel-of-normals -pon |
null | VCF file of sites observed in normal. | |
| --pedigree -ped |
null | Pedigree file for determining the population "founders" | |
| --population-callset -population |
null | Callset to use in calculating genotype priors | |
| --sample-ploidy -ploidy |
2 | Ploidy (number of chromosomes) per sample. For pooled data, set to (Number of samples in each pool * Sample Ploidy). | |
| --sites-only-vcf-output |
false | If true, don't emit genotype fields when writing vcf file output. | |
| --standard-min-confidence-threshold-for-calling -stand-call-conf |
10.0 | The minimum phred-scaled confidence threshold at which variants should be called | |
| --tumor-lod-to-emit -emit-lod |
3.0 | LOD threshold to emit variant to VCF. | |
| --tumor-sample -tumor |
null | BAM sample name of tumor. May be URL-encoded as output by GetSampleName with -encode argument. | |
| --use-new-qual-calculator -new-qual |
false | If provided, we will use the new AF model instead of the so-called exact model | |
| --version |
false | display the version number for this tool | |
| Optional Common Arguments | |||
| --add-output-sam-program-record |
true | If true, adds a PG tag to created SAM/BAM/CRAM files. | |
| --add-output-vcf-command-line |
true | If true, adds a command line header line to created VCF files. | |
| --create-output-bam-index -OBI |
true | If true, create a BAM/CRAM index when writing a coordinate-sorted BAM/CRAM file. | |
| --create-output-bam-md5 -OBM |
false | If true, create a MD5 digest for any BAM/SAM/CRAM file created | |
| --create-output-variant-index -OVI |
true | If true, create a VCF index when writing a coordinate-sorted VCF file. | |
| --create-output-variant-md5 -OVM |
false | If true, create a a MD5 digest any VCF file created. | |
| --disable-read-filter -DF |
[] | Read filters to be disabled before analysis | |
| --disable-tool-default-read-filters |
false | Disable all tool default read filters (WARNING: many tools will not function correctly without their default read filters on) | |
| --exclude-intervals -XL |
[] | One or more genomic intervals to exclude from processing | |
| --gatk-config-file |
null | A configuration file to use with the GATK. | |
| --interval-exclusion-padding -ixp |
0 | Amount of padding (in bp) to add to each interval you are excluding. | |
| --interval-padding -ip |
0 | Amount of padding (in bp) to add to each interval you are including. | |
| --interval-set-rule -isr |
UNION | Set merging approach to use for combining interval inputs | |
| --lenient -LE |
false | Lenient processing of VCF files | |
| --QUIET |
false | Whether to suppress job-summary info on System.err. | |
| --read-filter -RF |
[] | Read filters to be applied before analysis | |
| --read-index |
[] | Indices to use for the read inputs. If specified, an index must be provided for every read input and in the same order as the read inputs. If this argument is not specified, the path to the index for each input will be inferred automatically. | |
| --read-validation-stringency -VS |
SILENT | Validation stringency for all SAM/BAM/CRAM/SRA files read by this program. The default stringency value SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded. | |
| --seconds-between-progress-updates |
10.0 | Output traversal statistics every time this many seconds elapse | |
| --sequence-dictionary |
null | Use the given sequence dictionary as the master/canonical sequence dictionary. Must be a .dict file. | |
| --tmp-dir |
null | Temp directory to use. | |
| --use-jdk-deflater -jdk-deflater |
false | Whether to use the JdkDeflater (as opposed to IntelDeflater) | |
| --use-jdk-inflater -jdk-inflater |
false | Whether to use the JdkInflater (as opposed to IntelInflater) | |
| --verbosity |
INFO | Control verbosity of logging. | |
| Advanced Arguments | |||
| --active-probability-threshold |
0.002 | Minimum probability for a locus to be considered active. | |
| --adaptive-pruning-initial-error-rate |
0.001 | Initial base error rate estimate for adaptive pruning | |
| --all-site-pls |
false | Annotate all sites with PLs | |
| --allow-non-unique-kmers-in-ref |
false | Allow graphs that have non-unique kmers in the reference | |
| --assembly-region-padding |
100 | Number of additional bases of context to include around each assembly region | |
| --bam-output -bamout |
null | File to which assembled haplotypes should be written | |
| --bam-writer-type |
CALLED_HAPLOTYPES | Which haplotypes should be written to the BAM | |
| --contamination-fraction-per-sample-file -contamination-file |
null | Tab-separated File containing fraction of contamination in sequencing data (per sample) to aggressively remove. Format should be "" (Contamination is double) per line; No header. | |
| --debug |
false | Print out very verbose debug information about each triggering active region | |
| --disable-adaptive-pruning |
false | Disable the adaptive algorithm for pruning paths in the graph | |
| --disable-tool-default-annotations |
false | Disable all tool default annotations | |
| --do-not-run-physical-phasing |
false | Disable physical phasing | |
| --dont-increase-kmer-sizes-for-cycles |
false | Disable iterating over kmer sizes when graph cycles are detected | |
| --dont-trim-active-regions |
false | If specified, we will not trim down the active region from the full region (active + extension) to just the active interval for genotyping | |
| --dont-use-soft-clipped-bases |
false | Do not analyze soft clipped bases in the reads | |
| --enable-all-annotations |
false | Use all possible annotations (not for the faint of heart) | |
| --genotype-filtered-alleles |
false | Whether to genotype all given alleles, even filtered ones, --genotyping_mode is GENOTYPE_GIVEN_ALLELES | |
| --input-prior |
[] | Input prior for calls | |
| --kmer-size |
[10, 25] | Kmer size to use in the read threading assembler | |
| --max-alternate-alleles |
6 | Maximum number of alternate alleles to genotype | |
| --max-assembly-region-size |
300 | Maximum size of an assembly region | |
| --max-genotype-count |
1024 | Maximum number of genotypes to consider at any site | |
| --max-mnp-distance -mnp-dist |
1 | Two or more phased substitutions separated by this distance or less are merged into MNPs. | |
| --max-num-haplotypes-in-population |
128 | Maximum number of haplotypes to consider for your population | |
| --max-prob-propagation-distance |
50 | Upper limit on how many bases away probability mass can be moved around when calculating the boundaries between active and inactive assembly regions | |
| --max-suspicious-reads-per-alignment-start |
0 | Maximum number of suspicious reads (mediocre mapping quality or too many substitutions) allowed in a downsampling stride. Set to 0 to disable. | |
| --max-unpruned-variants |
100 | Maximum number of variants in graph the adaptive pruner will allow | |
| --median-autosomal-coverage |
0.0 | For mitochondrial calling only; Annotate possible polymorphic NuMT based on Poisson distribution given median autosomal coverage | |
| --min-assembly-region-size |
50 | Minimum size of an assembly region | |
| --min-dangling-branch-length |
4 | Minimum length of a dangling branch to attempt recovery | |
| --min-pruning |
2 | Minimum support to not prune paths in the graph | |
| --num-pruning-samples |
1 | Number of samples that must pass the minPruning threshold | |
| --pair-hmm-gap-continuation-penalty |
10 | Flat gap continuation penalty for use in the Pair HMM | |
| --pair-hmm-implementation -pairHMM |
FASTEST_AVAILABLE | The PairHMM implementation to use for genotype likelihood calculations | |
| --pcr-indel-model |
CONSERVATIVE | The PCR indel model to use | |
| --phred-scaled-global-read-mismapping-rate |
45 | The global assumed mismapping rate for reads | |
| --pruning-lod-threshold |
1.0 | Log-10 likelihood ratio threshold for adaptive pruning algorithm | |
| --showHidden |
false | display hidden arguments | |
| --smith-waterman |
JAVA | Which Smith-Waterman implementation to use, generally FASTEST_AVAILABLE is the right choice | |
| --use-filtered-reads-for-annotations |
false | Use the contamination-filtered read maps for the purposes of annotating variants | |
Argument details
Arguments in this list are specific to this tool. Keep in mind that other arguments are available that are shared with other tools (e.g. command-line GATK arguments); see Inherited arguments above.
--active-probability-threshold / NA
Minimum probability for a locus to be considered active.
double 0.002 [ [ -∞ ∞ ] ]
--activity-profile-out / NA
Output the raw activity profile results in IGV format
If provided, this walker will write out its activity profile (per bp probabilities of being active)
to this file in the IGV formatted TAB deliminated output:
http://www.broadinstitute.org/software/igv/IGV
Intended to make debugging the activity profile calculations easier
String null
--adaptive-pruning-initial-error-rate / NA
Initial base error rate estimate for adaptive pruning
Initial base error rate guess for the probabilistic adaptive pruning model. Results are not very sensitive to this
parameter because it is only a starting point from which the algorithm discovers the true error rate.
double 0.001 [ [ -∞ ∞ ] ]
--add-output-sam-program-record / -add-output-sam-program-record
If true, adds a PG tag to created SAM/BAM/CRAM files.
boolean true
--add-output-vcf-command-line / -add-output-vcf-command-line
If true, adds a command line header line to created VCF files.
boolean true
--af-of-alleles-not-in-resource / -default-af
Population allele fraction assigned to alleles not found in germline resource. Please see docs/mutect/mutect2.pdf fora derivation of the default value.
Population allele fraction assigned to alleles not found in germline resource.
double -1.0 [ [ -∞ ∞ ] ]
--all-site-pls / NA
Annotate all sites with PLs
Advanced, experimental argument: if SNP likelihood model is specified, and if EMIT_ALL_SITES output mode is set, when we set this argument then we will also emit PLs at all sites.
This will give a measure of reference confidence and a measure of which alt alleles are more plausible (if any).
WARNINGS:
- This feature will inflate VCF file size considerably.
- All SNP ALT alleles will be emitted with corresponding 10 PL values.
- An error will be emitted if EMIT_ALL_SITES is not set, or if anything other than diploid SNP model is used
boolean false
--alleles / NA
The set of alleles at which to genotype when --genotyping_mode is GENOTYPE_GIVEN_ALLELES
When the caller is put into GENOTYPE_GIVEN_ALLELES mode it will genotype the samples using only the alleles provide in this rod binding
FeatureInput[VariantContext] null
--allow-non-unique-kmers-in-ref / NA
Allow graphs that have non-unique kmers in the reference
By default, the program does not allow processing of reference sections that contain non-unique kmers. Disabling
this check may cause problems in the assembly graph.
boolean false
--annotate-with-num-discovered-alleles / NA
If provided, we will annotate records with the number of alternate alleles that were discovered (but not necessarily genotyped) at a given site
Depending on the value of the --max_alternate_alleles argument, we may genotype only a fraction of the alleles being sent on for genotyping.
Using this argument instructs the genotyper to annotate (in the INFO field) the number of alternate alleles that were originally discovered at the site.
boolean false
--annotation / -A
One or more specific annotations to add to variant calls
Which annotations to include in variant calls in the output. These supplement annotations provided by annotation groups.
List[String] []
--annotation-group / -G
One or more groups of annotations to apply to variant calls
Which groups of annotations to add to the output variant calls.
Any requirements that are not met (e.g. failing to provide a pedigree file for a pedigree-based annotation) may cause the run to fail.
List[String] []
--annotations-to-exclude / -AX
One or more specific annotations to exclude from variant calls
Which annotations to exclude from output in the variant calls. Note that this argument has higher priority than the
-A or -G arguments, so these annotations will be excluded even if they are explicitly included with the other
options.
List[String] []
--arguments_file / NA
read one or more arguments files and add them to the command line
List[File] []
--assembly-region-out / NA
Output the assembly region to this IGV formatted file
If provided, this walker will write out its assembly regions
to this file in the IGV formatted TAB-delimited output:
http://www.broadinstitute.org/software/igv/IGV
Intended to make debugging the active region calculations easier
String null
--assembly-region-padding / NA
Number of additional bases of context to include around each assembly region
int 100 [ [ -∞ ∞ ] ]
--bam-output / -bamout
File to which assembled haplotypes should be written
The assembled haplotypes and locally realigned reads will be written as BAM to this file if requested. Really
for debugging purposes only. Note that the output here does not include uninformative reads so that not every
input read is emitted to the bam.
Turning on this mode may result in serious performance cost for the caller. It's really only appropriate to
use in specific areas where you want to better understand why the caller is making specific calls.
The reads are written out containing an "HC" tag (integer) that encodes which haplotype each read best matches
according to the haplotype caller's likelihood calculation. The use of this tag is primarily intended
to allow good coloring of reads in IGV. Simply go to "Color Alignments By > Tag" and enter "HC" to more
easily see which reads go with these haplotype.
Note that the haplotypes (called or all, depending on mode) are emitted as single reads covering the entire
active region, coming from sample "HC" and a special read group called "ArtificialHaplotype". This will increase the
pileup depth compared to what would be expected from the reads only, especially in complex regions.
Note also that only reads that are actually informative about the haplotypes are emitted. By informative we mean
that there's a meaningful difference in the likelihood of the read coming from one haplotype compared to
its next best haplotype.
If multiple BAMs are passed as input to the tool (as is common for M2), then they will be combined in the bamout
output and tagged with the appropriate sample names.
The best way to visualize the output of this mode is with IGV. Tell IGV to color the alignments by tag,
and give it the "HC" tag, so you can see which reads support each haplotype. Finally, you can tell IGV
to group by sample, which will separate the potential haplotypes from the reads. All of this can be seen in
this screenshot
String null
--bam-writer-type / NA
Which haplotypes should be written to the BAM
The type of BAM output we want to see. This determines whether HC will write out all of the haplotypes it
considered (top 128 max) or just the ones that were selected as alleles and assigned to samples.
The --bam-writer-type argument is an enumerated type (WriterType), which can have one of the following values:
- ALL_POSSIBLE_HAPLOTYPES
- A mode that's for method developers. Writes out all of the possible haplotypes considered, as well as reads aligned to each
- CALLED_HAPLOTYPES
- A mode for users. Writes out the reads aligned only to the called haplotypes. Useful to understand why the caller is calling what it is
WriterType CALLED_HAPLOTYPES
--base-quality-score-threshold / NA
Base qualities below this threshold will be reduced to the minimum (6)
Bases with a quality below this threshold will reduced to the minimum usable qualiy score (6).
byte 18 [ [ -∞ ∞ ] ]
--cloud-index-prefetch-buffer / -CIPB
Size of the cloud-only prefetch buffer (in MB; 0 to disable). Defaults to cloudPrefetchBuffer if unset.
int -1 [ [ -∞ ∞ ] ]
--cloud-prefetch-buffer / -CPB
Size of the cloud-only prefetch buffer (in MB; 0 to disable).
int 40 [ [ -∞ ∞ ] ]
--contamination-fraction-per-sample-file / -contamination-file
Tab-separated File containing fraction of contamination in sequencing data (per sample) to aggressively remove. Format should be "" (Contamination is double) per line; No header.
This argument specifies a file with two columns "sample" and "contamination" specifying the contamination level for those samples.
Samples that do not appear in this file will be processed with CONTAMINATION_FRACTION.
File null
--contamination-fraction-to-filter / -contamination
Fraction of contamination in sequencing data (for all samples) to aggressively remove
If this fraction is greater is than zero, the caller will aggressively attempt to remove contamination through biased down-sampling of reads.
Basically, it will ignore the contamination fraction of reads for each alternate allele. So if the pileup contains N total bases, then we
will try to remove (N * contamination fraction) bases for each alternate allele.
double 0.0 [ [ -∞ ∞ ] ]
--correct-overlapping-quality / NA
Undocumented option
boolean false
--count-reads / NA
If true, strand-based annotations use the number of reads, not fragments
If set to true, count an overlapping read pair as two separate reads instead of one for {@link StrandArtifact} and {@link StrandBiasBySample} annotations,
which is the correct behavior for these annotations. Note that doing so would break the independence assumption of reads and over-count the alt depth in these annotations.
On the other hand it could prevent spurious false negatives that could arise if by chance one strand in overlapping pairs is dropped disproportionately
boolean false
--create-output-bam-index / -OBI
If true, create a BAM/CRAM index when writing a coordinate-sorted BAM/CRAM file.
boolean true
--create-output-bam-md5 / -OBM
If true, create a MD5 digest for any BAM/SAM/CRAM file created
boolean false
--create-output-variant-index / -OVI
If true, create a VCF index when writing a coordinate-sorted VCF file.
boolean true
--create-output-variant-md5 / -OVM
If true, create a a MD5 digest any VCF file created.
boolean false
--debug / -debug
Print out very verbose debug information about each triggering active region
boolean false
--disable-adaptive-pruning / NA
Disable the adaptive algorithm for pruning paths in the graph
A single edge multiplicity cutoff for pruning doesn't work in samples with variable depths, for example exomes
and RNA. This parameter disables the probabilistic algorithm for pruning the assembly graph that considers the
likelihood that each chain in the graph comes from real variation, and instead uses a simple multiplicity cutoff.
boolean false
--disable-bam-index-caching / -DBIC
If true, don't cache bam indexes, this will reduce memory requirements but may harm performance if many intervals are specified. Caching is automatically disabled if there are no intervals specified.
boolean false
--disable-read-filter / -DF
Read filters to be disabled before analysis
List[String] []
--disable-sequence-dictionary-validation / -disable-sequence-dictionary-validation
If specified, do not check the sequence dictionaries from our inputs for compatibility. Use at your own risk!
boolean false
--disable-tool-default-annotations / -disable-tool-default-annotations
Disable all tool default annotations
Hook allowing for the user to remove default annotations from the tool
boolean false
--disable-tool-default-read-filters / -disable-tool-default-read-filters
Disable all tool default read filters (WARNING: many tools will not function correctly without their default read filters on)
boolean false
--do-not-run-physical-phasing / NA
Disable physical phasing
As of GATK 3.3, HaplotypeCaller outputs physical (read-based) information (see version 3.3 release notes and documentation for details). This argument disables that behavior.
boolean false
--dont-increase-kmer-sizes-for-cycles / NA
Disable iterating over kmer sizes when graph cycles are detected
When graph cycles are detected, the normal behavior is to increase kmer sizes iteratively until the cycles are
resolved. Disabling this behavior may cause the program to give up on assembling the ActiveRegion.
boolean false
--dont-trim-active-regions / NA
If specified, we will not trim down the active region from the full region (active + extension) to just the active interval for genotyping
boolean false
--dont-use-soft-clipped-bases / NA
Do not analyze soft clipped bases in the reads
boolean false
--downsampling-stride / -stride
Downsample a pool of reads starting within a range of one or more bases.
Downsample a pool of reads starting within a range of one or more bases.
int 1 [ [ -∞ ∞ ] ]
--enable-all-annotations / NA
Use all possible annotations (not for the faint of heart)
You can use the -AX argument in combination with this one to exclude specific annotations. Note that some
annotations may not be actually applied if they are not applicable to the data provided or if they are
unavailable to the tool (e.g. there are several annotations that are currently not hooked up to
HaplotypeCaller). At present no error or warning message will be provided, the annotation will simply be
skipped silently. You can check the output VCF header to see which annotations were activated and thus might be applied (although
this does not guarantee that the annotation was applied to all records in the VCF, since some annotations have
additional requirements, e.g. minimum number of samples or heterozygous sites only -- see the documentation
for individual annotations' requirements).
boolean false
--exclude-intervals / -XL
One or more genomic intervals to exclude from processing
Use this argument to exclude certain parts of the genome from the analysis (like -L, but the opposite).
This argument can be specified multiple times. You can use samtools-style intervals either explicitly on the
command line (e.g. -XL 1 or -XL 1:100-200) or by loading in a file containing a list of intervals
(e.g. -XL myFile.intervals).
List[String] []
--founder-id / -founder-id
Samples representing the population "founders"
List[String] []
--gatk-config-file / NA
A configuration file to use with the GATK.
String null
--gcs-max-retries / -gcs-retries
If the GCS bucket channel errors out, how many times it will attempt to re-initiate the connection
int 20 [ [ -∞ ∞ ] ]
--gcs-project-for-requester-pays / NA
Project to bill when accessing "requester pays" buckets. If unset, these buckets cannot be accessed.
String ""
--genotype-filtered-alleles / NA
Whether to genotype all given alleles, even filtered ones, --genotyping_mode is GENOTYPE_GIVEN_ALLELES
When set to true an when in GENOTYPE_GIVEN_ALLELES mode all given alleles, even filtered ones, are genotyped
boolean false
--genotype-germline-sites / NA
(EXPERIMENTAL) Call all apparent germline site even though they will ultimately be filtered.
Usually we exclude sites in the panel of normals from active region determination, which saves time. Setting this to true
causes Mutect to produce a variant call at these sites. This call will still be filtered, but it shows up in the vcf.
boolean false
--genotype-pon-sites / NA
Call sites in the PoN even though they will ultimately be filtered.
Usually we exclude sites in the panel of normals from active region determination, which saves time. Setting this to true
causes Mutect to produce a variant call at these sites. This call will still be filtered, but it shows up in the vcf.
boolean false
--genotyping-mode / NA
Specifies how to determine the alternate alleles to use for genotyping
The --genotyping-mode argument is an enumerated type (GenotypingOutputMode), which can have one of the following values:
- DISCOVERY
- The genotyper will choose the most likely alternate allele
- GENOTYPE_GIVEN_ALLELES
- Only the alleles passed by the user should be considered.
GenotypingOutputMode DISCOVERY
--germline-resource / NA
Population vcf of germline sequencing containing allele fractions.
A resource, such as gnomAD, containing population allele frequencies of common and rare variants.
FeatureInput[VariantContext] null
--graph-output / -graph
Write debug assembly graph information to this file
This argument is meant for debugging and is not immediately useful for normal analysis use.
String null
--help / -h
display the help message
boolean false
--heterozygosity / NA
Heterozygosity value used to compute prior likelihoods for any locus. See the GATKDocs for full details on the meaning of this population genetics concept
The expected heterozygosity value used to compute prior probability that a locus is non-reference.
The default priors are for provided for humans:
het = 1e-3
which means that the probability of N samples being hom-ref at a site is:
1 - sum_i_2N (het / i)
Note that heterozygosity as used here is the population genetics concept:
http://en.wikipedia.org/wiki/Zygosity#Heterozygosity_in_population_genetics
That is, a hets value of 0.01 implies that two randomly chosen chromosomes from the population of organisms
would differ from each other (one being A and the other B) at a rate of 1 in 100 bp.
Note that this quantity has nothing to do with the likelihood of any given sample having a heterozygous genotype,
which in the GATK is purely determined by the probability of the observed data P(D | AB) under the model that there
may be a AB het genotype. The posterior probability of this AB genotype would use the het prior, but the GATK
only uses this posterior probability in determining the prob. that a site is polymorphic. So changing the
het parameters only increases the chance that a site will be called non-reference across all samples, but
doesn't actually change the output genotype likelihoods at all, as these aren't posterior probabilities at all.
The quantity that changes whether the GATK considers the possibility of a het genotype at all is the ploidy,
which determines how many chromosomes each individual in the species carries.
Double 0.001 [ [ -∞ ∞ ] ]
--heterozygosity-stdev / NA
Standard deviation of heterozygosity for SNP and indel calling.
The standard deviation of the distribution of alt allele fractions. The above heterozygosity parameters give the
*mean* of this distribution; this parameter gives its spread.
double 0.01 [ [ -∞ ∞ ] ]
--ignore-itr-artifacts / NA
Turn off read transformer that clips artifacts associated with end repair insertions near inverted tandem repeats.
When opposite ends of a fragment are inverted tandem repeats of each other, the sequence past one end may be copied onto the other
during library prep. By default, Mutect2 identifies and clips these artifacts, which are especially prevalent when
DNA is damaged as in the case of FFPE samples and ancient DNA.
boolean false
--indel-heterozygosity / NA
Heterozygosity for indel calling. See the GATKDocs for heterozygosity for full details on the meaning of this population genetics concept
This argument informs the prior probability of having an indel at a site.
double 1.25E-4 [ [ -∞ ∞ ] ]
--initial-pcr-qual / NA
PCR error rate for overlapping fragments in isActive()
PCR error rate for overlapping fragments in isActive()
int 40 [ [ -∞ ∞ ] ]
--initial-tumor-lod / -init-lod
LOD threshold to consider pileup active.
Only variants with estimated tumor LODs exceeding this threshold will be considered active.
double 2.0 [ [ -∞ ∞ ] ]
--input / -I
BAM/SAM/CRAM file containing reads
R List[String] []
--input-prior / NA
Input prior for calls
By default, the prior specified with the argument --heterozygosity/-hets is used for variant discovery at a particular locus, using an infinite sites model,
see e.g. Waterson (1975) or Tajima (1996).
This model asserts that the probability of having a population of k variant sites in N chromosomes is proportional to theta/k, for 1=1:N
There are instances where using this prior might not be desireable, e.g. for population studies where prior might not be appropriate,
as for example when the ancestral status of the reference allele is not known.
By using this argument, user can manually specify priors to be used for calling as a vector for doubles, with the following restriciotns:
a) User must specify 2N values, where N is the number of samples.
b) Only diploid calls supported.
c) Probability values are specified in double format, in linear space.
d) No negative values allowed.
e) Values will be added and Pr(AC=0) will be 1-sum, so that they sum up to one.
f) If user-defined values add to more than one, an error will be produced.
If user wants completely flat priors, then user should specify the same value (=1/(2*N+1)) 2*N times,e.g.
--input-prior 0.33 --input-prior 0.33
for the single-sample diploid case.
List[Double] []
--interval-exclusion-padding / -ixp
Amount of padding (in bp) to add to each interval you are excluding.
Use this to add padding to the intervals specified using -XL. For example, '-XL 1:100' with a
padding value of 20 would turn into '-XL 1:80-120'. This is typically used to add padding around targets when
analyzing exomes.
int 0 [ [ -∞ ∞ ] ]
--interval-merging-rule / -imr
Interval merging rule for abutting intervals
By default, the program merges abutting intervals (i.e. intervals that are directly side-by-side but do not
actually overlap) into a single continuous interval. However you can change this behavior if you want them to be
treated as separate intervals instead.
The --interval-merging-rule argument is an enumerated type (IntervalMergingRule), which can have one of the following values:
- ALL
- OVERLAPPING_ONLY
IntervalMergingRule ALL
--interval-padding / -ip
Amount of padding (in bp) to add to each interval you are including.
Use this to add padding to the intervals specified using -L. For example, '-L 1:100' with a
padding value of 20 would turn into '-L 1:80-120'. This is typically used to add padding around targets when
analyzing exomes.
int 0 [ [ -∞ ∞ ] ]
--interval-set-rule / -isr
Set merging approach to use for combining interval inputs
By default, the program will take the UNION of all intervals specified using -L and/or -XL. However, you can
change this setting for -L, for example if you want to take the INTERSECTION of the sets instead. E.g. to
perform the analysis only on chromosome 1 exomes, you could specify -L exomes.intervals -L 1 --interval-set-rule
INTERSECTION. However, it is not possible to modify the merging approach for intervals passed using -XL (they will
always be merged using UNION).
Note that if you specify both -L and -XL, the -XL interval set will be subtracted from the -L interval set.
The --interval-set-rule argument is an enumerated type (IntervalSetRule), which can have one of the following values:
- UNION
- Take the union of all intervals
- INTERSECTION
- Take the intersection of intervals (the subset that overlaps all intervals specified)
IntervalSetRule UNION
--intervals / -L
One or more genomic intervals over which to operate
List[String] []
--kmer-size / NA
Kmer size to use in the read threading assembler
Multiple kmer sizes can be specified, using e.g. `--kmer-size 10 --kmer-size 25`.
List[Integer] [10, 25]
--lenient / -LE
Lenient processing of VCF files
boolean false
--max-alternate-alleles / NA
Maximum number of alternate alleles to genotype
If there are more than this number of alternate alleles presented to the genotyper (either through discovery or GENOTYPE_GIVEN ALLELES),
then only this many alleles will be used. Note that genotyping sites with many alternate alleles is both CPU and memory intensive and it
scales exponentially based on the number of alternate alleles. Unless there is a good reason to change the default value, we highly recommend
that you not play around with this parameter.
See also {@link #MAX_GENOTYPE_COUNT}.
int 6 [ [ -∞ ∞ ] ]
--max-assembly-region-size / NA
Maximum size of an assembly region
int 300 [ [ -∞ ∞ ] ]
--max-genotype-count / NA
Maximum number of genotypes to consider at any site
If there are more than this number of genotypes at a locus presented to the genotyper, then only this many genotypes will be used.
The possible genotypes are simply different ways of partitioning alleles given a specific ploidy asumption.
Therefore, we remove genotypes from consideration by removing alternate alleles that are the least well supported.
The estimate of allele support is based on the ranking of the candidate haplotypes coming out of the graph building step.
Note that the reference allele is always kept.
Note that genotyping sites with large genotype counts is both CPU and memory intensive.
Unless there is a good reason to change the default value, we highly recommend that you not play around with this parameter.
The maximum number of alternative alleles used in the genotyping step will be the lesser of the two:
1. the largest number of alt alleles, given ploidy, that yields a genotype count no higher than {@link #MAX_GENOTYPE_COUNT}
2. the value of {@link #MAX_ALTERNATE_ALLELES}
See also {@link #MAX_ALTERNATE_ALLELES}.
int 1024 [ [ -∞ ∞ ] ]
--max-mnp-distance / -mnp-dist
Two or more phased substitutions separated by this distance or less are merged into MNPs.
Two or more phased substitutions separated by this distance or less are merged into MNPs.
int 1 [ [ -∞ ∞ ] ]
--max-num-haplotypes-in-population / NA
Maximum number of haplotypes to consider for your population
The assembly graph can be quite complex, and could imply a very large number of possible haplotypes. Each haplotype
considered requires N PairHMM evaluations if there are N reads across all samples. In order to control the
run of the haplotype caller we only take maxNumHaplotypesInPopulation paths from the graph, in order of their
weights, no matter how many paths are possible to generate from the graph. Putting this number too low
will result in dropping true variation because paths that include the real variant are not even considered.
You can consider increasing this number when calling organisms with high heterozygosity.
int 128 [ [ -∞ ∞ ] ]
--max-population-af / -max-af
Maximum population allele frequency in tumor-only mode.
In tumor-only mode, we discard variants with population allele frequencies greater than this threshold.
double 0.01 [ [ -∞ ∞ ] ]
--max-prob-propagation-distance / NA
Upper limit on how many bases away probability mass can be moved around when calculating the boundaries between active and inactive assembly regions
int 50 [ [ -∞ ∞ ] ]
--max-reads-per-alignment-start / NA
Maximum number of reads to retain per alignment start position. Reads above this threshold will be downsampled. Set to 0 to disable.
int 50 [ [ -∞ ∞ ] ]
--max-suspicious-reads-per-alignment-start / NA
Maximum number of suspicious reads (mediocre mapping quality or too many substitutions) allowed in a downsampling stride. Set to 0 to disable.
Maximum number of suspicious reads (mediocre mapping quality or too many substitutions) allowed in a downsampling stride.
int 0 [ [ -∞ ∞ ] ]
--max-unpruned-variants / NA
Maximum number of variants in graph the adaptive pruner will allow
The maximum number of variants in graph the adaptive pruner will allow
int 100 [ [ -∞ ∞ ] ]
--median-autosomal-coverage / NA
For mitochondrial calling only; Annotate possible polymorphic NuMT based on Poisson distribution given median autosomal coverage
Used to model autosomal coverage when calling mitochondria. The median tends to be a more robust center statistic.
double 0.0 [ [ -∞ ∞ ] ]
--min-assembly-region-size / NA
Minimum size of an assembly region
int 50 [ [ -∞ ∞ ] ]
--min-base-quality-score / -mbq
Minimum base quality required to consider a base for calling
Bases with a quality below this threshold will not be used for calling.
byte 10 [ [ -∞ ∞ ] ]
--min-dangling-branch-length / NA
Minimum length of a dangling branch to attempt recovery
When constructing the assembly graph we are often left with "dangling" branches. The assembly engine attempts to rescue these branches
by merging them back into the main graph. This argument describes the minimum length of a dangling branch needed for the engine to
try to rescue it. A smaller number here will lead to higher sensitivity to real variation but also to a higher number of false positives.
int 4 [ [ -∞ ∞ ] ]
--min-pruning / NA
Minimum support to not prune paths in the graph
Paths with fewer supporting kmers than the specified threshold will be pruned from the graph.
Be aware that this argument can dramatically affect the results of variant calling and should only be used with great caution.
Using a prune factor of 1 (or below) will prevent any pruning from the graph, which is generally not ideal; it can make the
calling much slower and even less accurate (because it can prevent effective merging of "tails" in the graph). Higher values
tend to make the calling much faster, but also lowers the sensitivity of the results (because it ultimately requires higher
depth to produce calls).
int 2 [ [ -∞ ∞ ] ]
--mitochondria-mode / NA
Mitochondria mode sets emission and initial LODs to 0.
Mitochondria mode changes default values for --tumor-lod-to-emit and --initial-tumor-lod to 0 to increase sensitivity.
--tumor-sample is also not explicitly required in mitochondria mode since a single sample bam is expected as input.
Mitochondria mode is also required in FilterMutectCalls if used here.
Boolean false
--native-pair-hmm-threads / NA
How many threads should a native pairHMM implementation use
int 4 [ [ -∞ ∞ ] ]
--native-pair-hmm-use-double-precision / NA
use double precision in the native pairHmm. This is slower but matches the java implementation better
boolean false
--normal-lod / NA
LOD threshold for calling normal variant non-germline.
This is a measure of the minimum evidence to support that a variant observed in the tumor is not also present in the normal.
Applies to normal data in a tumor with matched normal analysis. The default has been tuned for diploid somatic analyses.
It is unlikely such analyses will require changing the default value. Increasing the parameter may increase the sensitivity of somatic calling,
but may also increase calling false positive, i.e. germline, variants.
double 2.2 [ [ -∞ ∞ ] ]
--normal-sample / -normal
BAM sample name of normal. May be URL-encoded as output by GetSampleName with -encode argument.
String null
--num-pruning-samples / NA
Number of samples that must pass the minPruning threshold
If fewer samples than the specified number pass the minPruning threshold for a given path, that path will be eliminated from the graph.
int 1 [ [ -∞ ∞ ] ]
--num-reference-samples-if-no-call / NA
Number of hom-ref genotypes to infer at sites not present in a panel
When a variant is not seen in any panel, this argument controls whether to infer (and with what effective strength)
that only reference alleles were observed at that site. E.g. "If not seen in 1000Genomes, treat it as AC=0,
AN=2000".
int 0 [ [ -∞ ∞ ] ]
--orientation-bias-artifact-priors / NA
table of prior artifact probabilities for the read orientation filter model
File null
--output / -O
File to which variants should be written
R File null
--output-mode / NA
Specifies which type of calls we should output
The --output-mode argument is an enumerated type (OutputMode), which can have one of the following values:
- EMIT_VARIANTS_ONLY
- produces calls only at variant sites
- EMIT_ALL_CONFIDENT_SITES
- produces calls at variant sites and confident reference sites
- EMIT_ALL_SITES
- produces calls at any callable site regardless of confidence; this argument is intended only for point mutations (SNPs) in DISCOVERY mode or generally when running in GENOTYPE_GIVEN_ALLELES mode; it will by no means produce a comprehensive set of indels in DISCOVERY mode
OutputMode EMIT_VARIANTS_ONLY
--pair-hmm-gap-continuation-penalty / NA
Flat gap continuation penalty for use in the Pair HMM
int 10 [ [ -∞ ∞ ] ]
--pair-hmm-implementation / -pairHMM
The PairHMM implementation to use for genotype likelihood calculations
The PairHMM implementation to use for genotype likelihood calculations. The various implementations balance a tradeoff of accuracy and runtime.
The --pair-hmm-implementation argument is an enumerated type (Implementation), which can have one of the following values:
- EXACT
- ORIGINAL
- LOGLESS_CACHING
- AVX_LOGLESS_CACHING
- AVX_LOGLESS_CACHING_OMP
- EXPERIMENTAL_FPGA_LOGLESS_CACHING
- FASTEST_AVAILABLE
Implementation FASTEST_AVAILABLE
--panel-of-normals / -pon
VCF file of sites observed in normal.
A panel of normals can be a useful (optional) input to help filter out commonly seen sequencing noise that may appear as low allele-fraction somatic variants.
FeatureInput[VariantContext] null
--pcr-indel-model / NA
The PCR indel model to use
When calculating the likelihood of variants, we can try to correct for PCR errors that cause indel artifacts.
The correction is based on the reference context, and acts specifically around repetitive sequences that tend
to cause PCR errors). The variant likelihoods are penalized in increasing scale as the context around a
putative indel is more repetitive (e.g. long homopolymer). The correction can be disabling by specifying
'-pcrModel NONE'; in that case the default base insertion/deletion qualities will be used (or taken from the
read if generated through the BaseRecalibrator). VERY IMPORTANT: when using PCR-free sequencing data we
definitely recommend setting this argument to NONE.
The --pcr-indel-model argument is an enumerated type (PCRErrorModel), which can have one of the following values:
- NONE
- no specialized PCR error model will be applied; if base insertion/deletion qualities are present they will be used
- HOSTILE
- a most aggressive model will be applied that sacrifices true positives in order to remove more false positives
- AGGRESSIVE
- a more aggressive model will be applied that sacrifices true positives in order to remove more false positives
- CONSERVATIVE
- a less aggressive model will be applied that tries to maintain a high true positive rate at the expense of allowing more false positives
PCRErrorModel CONSERVATIVE
--pedigree / -ped
Pedigree file for determining the population "founders"
File null
--phred-scaled-global-read-mismapping-rate / NA
The global assumed mismapping rate for reads
The phredScaledGlobalReadMismappingRate reflects the average global mismapping rate of all reads, regardless of their
mapping quality. This term effects the probability that a read originated from the reference haplotype, regardless of
its edit distance from the reference, in that the read could have originated from the reference haplotype but
from another location in the genome. Suppose a read has many mismatches from the reference, say like 5, but
has a very high mapping quality of 60. Without this parameter, the read would contribute 5 * Q30 evidence
in favor of its 5 mismatch haplotype compared to reference, potentially enough to make a call off that single
read for all of these events. With this parameter set to Q30, though, the maximum evidence against any haplotype
that this (and any) read could contribute is Q30.
Set this term to any negative number to turn off the global mapping rate.
int 45 [ [ -∞ ∞ ] ]
--population-callset / -population
Callset to use in calculating genotype priors
Supporting external panel. Allele counts from this panel (taken from AC,AN or MLEAC,AN or raw genotypes) will
be used to inform the frequency distribution underlying the genotype priors. These files must be VCF 4.2 spec or later.
Note that unlike CalculateGenotypePosteriors, HaplotypeCaller only allows one supporting callset.
FeatureInput[VariantContext] null
--pruning-lod-threshold / NA
Log-10 likelihood ratio threshold for adaptive pruning algorithm
Log-10 likelihood ratio threshold for adaptive pruning algorithm.
double 1.0 [ [ -∞ ∞ ] ]
--QUIET / NA
Whether to suppress job-summary info on System.err.
Boolean false
--read-filter / -RF
Read filters to be applied before analysis
List[String] []
--read-index / -read-index
Indices to use for the read inputs. If specified, an index must be provided for every read input and in the same order as the read inputs. If this argument is not specified, the path to the index for each input will be inferred automatically.
List[String] []
--read-validation-stringency / -VS
Validation stringency for all SAM/BAM/CRAM/SRA files read by this program. The default stringency value SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded.
The --read-validation-stringency argument is an enumerated type (ValidationStringency), which can have one of the following values:
- STRICT
- LENIENT
- SILENT
ValidationStringency SILENT
--reference / -R
Reference sequence file
R String null
--sample-ploidy / -ploidy
Ploidy (number of chromosomes) per sample. For pooled data, set to (Number of samples in each pool * Sample Ploidy).
Sample ploidy - equivalent to number of chromosomes per pool. In pooled experiments this should be = # of samples in pool * individual sample ploidy
int 2 [ [ -∞ ∞ ] ]
--seconds-between-progress-updates / -seconds-between-progress-updates
Output traversal statistics every time this many seconds elapse
double 10.0 [ [ -∞ ∞ ] ]
--sequence-dictionary / -sequence-dictionary
Use the given sequence dictionary as the master/canonical sequence dictionary. Must be a .dict file.
String null
--showHidden / -showHidden
display hidden arguments
boolean false
--sites-only-vcf-output / NA
If true, don't emit genotype fields when writing vcf file output.
boolean false
--smith-waterman / NA
Which Smith-Waterman implementation to use, generally FASTEST_AVAILABLE is the right choice
The --smith-waterman argument is an enumerated type (Implementation), which can have one of the following values:
- FASTEST_AVAILABLE
- use the fastest available Smith-Waterman aligner that runs on your hardware
- AVX_ENABLED
- use the AVX enabled Smith-Waterman aligner
- JAVA
- use the pure java implementation of Smith-Waterman, works on all hardware
Implementation JAVA
--standard-min-confidence-threshold-for-calling / -stand-call-conf
The minimum phred-scaled confidence threshold at which variants should be called
The minimum phred-scaled confidence threshold at which variants should be called. Only variant sites with QUAL equal
or greater than this threshold will be called. Note that since version 3.7, we no longer differentiate high confidence
from low confidence calls at the calling step. The default call confidence threshold is set low intentionally to achieve
high sensitivity, which will allow false positive calls as a side effect. Be sure to perform some kind of filtering after
calling to reduce the amount of false positives in your final callset. Note that when HaplotypeCaller is used in GVCF mode
(using either -ERC GVCF or -ERC BP_RESOLUTION) the call threshold is automatically set to zero. Call confidence thresholding
will then be performed in the subsequent GenotypeGVCFs command.
double 10.0 [ [ -∞ ∞ ] ]
--tmp-dir / NA
Temp directory to use.
String null
--tumor-lod-to-emit / -emit-lod
LOD threshold to emit variant to VCF.
Only variants with tumor LODs exceeding this threshold will be written to the VCF, regardless of filter status.
Set to less than or equal to tumor_lod. Increase argument value to reduce false positives in the callset.
Default setting of 3 is permissive and will emit some amount of negative training data that
{@link FilterMutectCalls} should then filter.
double 3.0 [ [ -∞ ∞ ] ]
--tumor-sample / -tumor
BAM sample name of tumor. May be URL-encoded as output by GetSampleName with -encode argument.
String null
--use-filtered-reads-for-annotations / NA
Use the contamination-filtered read maps for the purposes of annotating variants
boolean false
--use-jdk-deflater / -jdk-deflater
Whether to use the JdkDeflater (as opposed to IntelDeflater)
boolean false
--use-jdk-inflater / -jdk-inflater
Whether to use the JdkInflater (as opposed to IntelInflater)
boolean false
--use-new-qual-calculator / -new-qual
If provided, we will use the new AF model instead of the so-called exact model
Use the new allele frequency / QUAL score model
boolean false
--verbosity / -verbosity
Control verbosity of logging.
The --verbosity argument is an enumerated type (LogLevel), which can have one of the following values:
- ERROR
- WARNING
- INFO
- DEBUG
LogLevel INFO
--version / NA
display the version number for this tool
boolean false
GATK version 4.0.12.0 built at 23-45-2019 03:45:45.
0 comments
Please sign in to leave a comment.