I'm trying to combine some gVCFs using GenomicsDBImport and am getting an error on the first gVCF line containing an explicit allele in addition to <NON_REF>, i.e. C,<NON_REF>. The error reads 

"FicticiousSampName_stream", at contig "chr21", position 8530392, for sample "FicticiousSampName", the field AS_UNIQ_ALT_READ_COUNT has 1 elements; expected 2

The relevant gVCF line is 

chr21   8530392 .       A       C,<NON_REF>     111.64  .       AS_RAW_BaseQRankSum=|-0.8,1|NaN;AS_RAW_MQ=2628.00|3988.00|0.00;AS_RAW_MQRankSum=|0.5,1|NaN;AS_RAW_ReadPosRankSum=|1.2,1|NaN;AS_SB_TABLE=4,0|1,3|0,0;AS_UNIQ_ALT_READ_COUNT=4|0;BaseQRankSum=-0.792;ClippingRankSum=-1.006;DP=10;ExcessHet=3.0103;GQ_MEAN=97.00;LikelihoodRankSum=0.545;MBQ=38,38,0;MFRL=332,211,0;MLEAC=1,0;MLEAF=0.500,0.00;MMQ=27,31,60;MPOS=53,50;MQ0=0;MQRankSum=0.545;NCC=0;NCount=0;RAW_MQandDP=8074,10;REF_BASES=TTTCATTTCAATTAAAAGGAA;ReadPosRankSum=1.282;Samples=FicticiousSampName GT:AD:AF:DP:F1R2:F2R1:GQ:PL:SB  0/1:4,4,0:0.500,0.00:8:1,0,0:3,4,0:97:119,0,97,131,109,240:4,0,1,3

Right now I'm only using 12 gVCFs as a trial run, but I plan eventually to eventually combine around 150  (which is why I'm not using CombineGVCFs). 

My problem is similar to the one described here https://gatk.broadinstitute.org/hc/en-us/community/posts/360076974412-CombineGVCFs-splitting-MNPs-into-individual-positions  except that I don't have any MNPs, unless "C,<NON_REF>" counts as an MNP. I can be sure the data have no true MNPs because HaplotypeCaller was run with the option "--max-mnp-distance 0."

Any help you could offer would be enormously appreciated. Specs are below. Thanks!

a) GATK version used:

4.1.9.0

b) Exact command used:

gatk-4.1.9.0/gatk --java-options "-Xmx4g -Xms4g" GenomicsDBImport \
 --genomicsdb-workspace-path /my/db/path \
 --V variants_0_chr21.g.vcf.gz \
 --V variants_1_chr21.g.vcf.gz \
 --V variants_2_chr21.g.vcf.gz \
 --V variants_3_chr21.g.vcf.gz \
 --V variants_4_chr21.g.vcf.gz \
 --V variants_5_chr21.g.vcf.gz \
 --V variants_6_chr21.g.vcf.gz \
 --V variants_7_chr21.g.vcf.gz \
 --V variants_8_chr21.g.vcf.gz \
 --V variants_9_chr21.g.vcf.gz \
 --V variants_10_chr21.g.vcf.gz \
 --V variants_11_chr21.g.vcf.gz \
 --tmp-dir /my/tmp/dir \
 -L chr21:1-43000000

c) Entire program log: 

Using GATK jar /gatkpath/gatk-4.1.9.0/gatk-package-4.1.9.0-local.jar
Running:
    java -Dsamjdk.use_async_io_read_samtools=false -Dsamjdk.use_async_io_write_samtools=true -Dsamjdk.use_async_io_write_tribble=false -Dsamjdk.compression_level=2 -Xmx4g -Xms4g -jar /igm/apps/gatk/gatk-4.1.9.0/gatk-package-4.1.9.0-local.jar GenomicsDBImport --genomicsdb-workspace-path /my/db/path --V /my/db/pathgap_031222/filt/dbgap_0_chr21.g.vcf.gz --V /my/db/pathgap_031222/filt/dbgap_1_chr21.g.vcf.gz --V /my/db/pathgap_031222/filt/dbgap_2_chr21.g.vcf.gz --V /my/db/pathgap_031222/filt/dbgap_3_chr21.g.vcf.gz --V /my/db/pathgap_031222/filt/dbgap_4_chr21.g.vcf.gz --V /my/db/pathgap_031222/filt/dbgap_5_chr21.g.vcf.gz --V /my/db/pathgap_031222/filt/dbgap_6_chr21.g.vcf.gz --V /my/db/pathgap_031222/filt/dbgap_7_chr21.g.vcf.gz --V /my/db/pathgap_031222/filt/dbgap_8_chr21.g.vcf.gz --V /my/db/pathgap_031222/filt/dbgap_9_chr21.g.vcf.gz --V /my/db/pathgap_031222/filt/dbgap_10_chr21.g.vcf.gz --V /my/db/pathgap_031222/filt/dbgap_11_chr21.g.vcf.gz --tmp-dir /igm/temp/genomicsdb_tmp_030922 -L chr21:1-43000000
16:32:14.470 INFO  NativeLibraryLoader - Loading libgkl_compression.so from jar:file:gatk-4.1.9.0/gatk-package-4.1.9.0-local.jar!/com/intel/gkl/native/libgkl_compression.so
Mar 12, 2022 4:32:14 PM shaded.cloud_nio.com.google.auth.oauth2.ComputeEngineCredentials runningOnComputeEngine
INFO: Failed to detect whether we are running on Google Compute Engine.
16:32:14.601 INFO  GenomicsDBImport - ------------------------------------------------------------
16:32:14.602 INFO  GenomicsDBImport - The Genome Analysis Toolkit (GATK) v4.1.9.0
16:32:14.602 INFO  GenomicsDBImport - For support and documentation go to https://software.broadinstitute.org/gatk/
16:32:14.602 INFO  GenomicsDBImport - Executing as jeff@jeff_system on Linux v3.10.0-1160.53.1.el7.x86_64 amd64
16:32:14.602 INFO  GenomicsDBImport - Java runtime: Eclipse OpenJ9 VM v1.8.0_242-b08
16:32:14.602 INFO  GenomicsDBImport - Start Date/Time: March 12, 2022 4:32:14 PM EST
16:32:14.602 INFO  GenomicsDBImport - ------------------------------------------------------------
16:32:14.602 INFO  GenomicsDBImport - ------------------------------------------------------------
16:32:14.603 INFO  GenomicsDBImport - HTSJDK Version: 2.23.0
16:32:14.603 INFO  GenomicsDBImport - Picard Version: 2.23.3
16:32:14.603 INFO  GenomicsDBImport - HTSJDK Defaults.COMPRESSION_LEVEL : 2
16:32:14.603 INFO  GenomicsDBImport - HTSJDK Defaults.USE_ASYNC_IO_READ_FOR_SAMTOOLS : false
16:32:14.603 INFO  GenomicsDBImport - HTSJDK Defaults.USE_ASYNC_IO_WRITE_FOR_SAMTOOLS : true
16:32:14.603 INFO  GenomicsDBImport - HTSJDK Defaults.USE_ASYNC_IO_WRITE_FOR_TRIBBLE : false
16:32:14.603 INFO  GenomicsDBImport - Deflater: IntelDeflater
16:32:14.603 INFO  GenomicsDBImport - Inflater: IntelInflater
16:32:14.603 INFO  GenomicsDBImport - GCS max retries/reopens: 20
16:32:14.603 INFO  GenomicsDBImport - Requester pays: disabled
16:32:14.603 INFO  GenomicsDBImport - Initializing engine
16:32:16.127 INFO  IntervalArgumentCollection - Processing 43000000 bp from intervals
16:32:16.128 INFO  GenomicsDBImport - Done initializing engine
16:32:16.434 INFO  GenomicsDBLibLoader - GenomicsDB native library version : 1.3.2-e18fa63
16:32:16.447 INFO  GenomicsDBImport - Vid Map JSON file will be written to /my/db/path/vidmap.json
16:32:16.447 INFO  GenomicsDBImport - Callset Map JSON file will be written to /my/db/path/callset.json
16:32:16.447 INFO  GenomicsDBImport - Complete VCF Header will be written to /my/db/path/vcfheader.vcf
16:32:16.447 INFO  GenomicsDBImport - Importing to workspace - /my/db/path
16:32:16.447 INFO  ProgressMeter - Starting traversal
16:32:16.447 INFO  ProgressMeter -        Current Locus  Elapsed Minutes     Batches Processed   Batches/Minute
16:32:17.090 INFO  GenomicsDBImport - Importing batch 1 with 12 samples
terminate called after throwing an instance of 'VCF2BinaryException'
  what():  VCF2BinaryException : Mismatch in field length and field length descriptor:
Length descriptor in vid/VCF header specifies that field "AS_UNIQ_ALT_READ_COUNT" should contain A element(s).
In file/stream "FicticiousSampName_stream", at contig "chr21", position 8530392, for sample "FicticiousSampName", the field AS_UNIQ_ALT_READ_COUNT has 1 elements; expected 2
JVMDUMP039I Processing dump event "abort", detail "" at 2022/03/12 16:32:18 - please wait.
JVMDUMP032I JVM requested System dump using '/my/script/dir/core.20220312.163218.43926.0001.dmp' in response to an event
JVMDUMP012E Error in System dump: The core file created by child process with pid = 43995 was not found. Expected to find core file with name "/my/script/dir/core.43995"
JVMDUMP032I JVM requested Java dump using '/my/script/dir/javacore.20220312.163218.43926.0002.txt' in response to an event
JVMDUMP010I Java dump written to /my/script/dir/javacore.20220312.163218.43926.0002.txt
JVMDUMP032I JVM requested Snap dump using '/my/script/dir/Snap.20220312.163218.43926.0003.trc' in response to an event
JVMDUMP010I Snap dump written to /my/script/dir/Snap.20220312.163218.43926.0003.trc
JVMDUMP007I JVM Requesting JIT dump using '/my/script/dir/jitdump.20220312.163218.43926.0004.dmp'
JVMDUMP010I JIT dump written to /my/script/dir/jitdump.20220312.163218.43926.0004.dmp
JVMDUMP013I Processed dump event "abort", detail "".