Errors in bam files
Answered
Hello
I am stuck in one of the preprocessing steps for exome analysis. Created unmapped and sorted bam files from original fastq files. Also, created aligned and sorted bam files. The unmapped and aligned bam files were validated (using validateSamFile command) and the files showed no errors. The unmapped and aligned bam files were merged (https://gatk.broadinstitute.org/hc/en-us/articles/360037056392-MergeBamAlignment-Picard-#--ALIGNED_READS_ONLY). The merged bam file was also validated (ValidateSamFile command) and it shows these following errors:
Error Type Count
ERROR:MATES_ARE_SAME_END 7458
ERROR:MISMATCH_FLAG_MATE_NEG_STRAND 7448
ERROR:MISMATCH_MATE_CIGAR_STRING 4272
How to remove these errors in the merged bam files?
Thanks
-
Hi Priyadarshini Thirunavukkarasu,
Did you find a resolution to the question you posted before? I want to make sure I fully understand what you have tried so far.
Best,
Genevieve
-
This time, I validated the unmapped and aligned bam files before merging into one bam file and there was no error. After merging I see the errors (posted in the question above) in the merged bam file. Is these errors are due to merging the unmapped bam file?. Does the unmapped bam file causes these errors? . I am trying to follow the recent pipeline for exome analysis (https://gatk.broadinstitute.org/hc/en-us/articles/360039568932--How-to-Map-and-clean-up-short-read-sequence-data-efficiently), merging the unmapped and aligned bam file and proceeding with marking duplicates and base recalibration steps. Please advice me on the preprocessing steps. I am still confused if it is okay to follow the previous GATK pipeline, where raw unmapped reads in fastq files are aligned with reference and sorted, then duplicates are marked and base recalibrated or create unmapped bam files from fastq files and merge with aligned bam file
-
I see, thanks for updating me with these steps. Could you try FixMateInformation and see if this resolves these issues?
If not, please also share your command line information from MergeBamAlignment and the entire program log.
-
Yes, the error was there in the merged bam files after running FixMateInformation.
This was the command used to use merge unmapped and mapped bam files:
java -jar $EBROOTPICARD/picard.jar MergeBamAlignment \
ALIGNED=aligned.sorted.bam \
UNMAPPED=unmapped_adaptermarked_sorted.bam \
O=1_merge.bam \
R=gch38.fa \
SORT_ORDER=coordinate \
CREATE_INDEX=true
To execute picard run: java -jar $EBROOTPICARD/picard.jar
[Tue Sep 21 13:10:19 CEST 2021] picard.sam.MergeBamAlignment UNMAPPED_BAM=unmapped_adaptermarked_sorted.bam ALIGNED_BAM=[aligned.sorted.bam] OUTPUT=1_merge.bam REFERENCE_SEQUENCE=gch38.fa SORT_ORDER=coordinate CREATE_INDEX=true PAIRED_RUN=true CLIP_ADAPTERS=true IS_BISULFITE_SEQUENCE=false ALIGNED_READS_ONLY=false MAX_INSERTIONS_OR_DELETIONS=1 READ1_TRIM=0 READ2_TRIM=0 ALIGNER_PROPER_PAIR_FLAGS=false PRIMARY_ALIGNMENT_STRATEGY=BestMapq CLIP_OVERLAPPING_READS=true INCLUDE_SECONDARY_ALIGNMENTS=true ADD_MATE_CIGAR=true UNMAP_CONTAMINANT_READS=false MIN_UNCLIPPED_BASES=32 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json
[Tue Sep 21 13:10:20 CEST 2021] Executing as thirun0000@shi109.cluster.bc2.ch on Linux 3.10.0-1160.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 1.8.0_212-b03; Picard version: 2.6.0-SNAPSHOT
INFO 2021-09-21 13:10:56 SamAlignmentMerger [aligned_sample1_unmapped.sorted.bam]
INFO 2021-09-21 13:15:57 AbstractAlignmentMerger Merged 1,000,000 records. Elapsed time: 00:05:30s. Time for last 1,000,000: 251s. Last read position: NC_000003.12:169,239,505
INFO 2021-09-21 13:26:54 AbstractAlignmentMerger Merged 2,000,000 records. Elapsed time: 00:16:24s. Time for last 1,000,000: 654s. Last read position: NC_000016.10:48,487,287
INFO 2021-09-21 13:41:03 AbstractAlignmentMerger Merged 3,000,000 records. Elapsed time: 00:30:34s. Time for last 1,000,000: 849s. Last read position: NC_000022.11:50,444,052
INFO 2021-09-21 13:56:52 AbstractAlignmentMerger Merged 4,000,000 records. Elapsed time: 00:46:24s. Time for last 1,000,000: 949s. Last read position: NC_000006.12:32,212,708
INFO 2021-09-21 14:02:24 AbstractAlignmentMerger Merged 5,000,000 records. Elapsed time: 00:51:56s. Time for last 1,000,000: 332s. Last read position: NC_000010.11:25,176,005
INFO 2021-09-21 14:09:37 AbstractAlignmentMerger Merged 6,000,000 records. Elapsed time: 00:59:09s. Time for last 1,000,000: 433s. Last read position: NC_000017.11:10,309,722
INFO 2021-09-21 14:10:07 AbstractAlignmentMerger Merged 7,000,000 records. Elapsed time: 00:59:40s. Time for last 1,000,000: 30s. Last read position: NC_000001.11:236,880,732
INFO 2021-09-21 14:10:25 AbstractAlignmentMerger Merged 8,000,000 records. Elapsed time: 00:59:58s. Time for last 1,000,000: 17s. Last read position: NC_000017.11:42,785,090
INFO 2021-09-21 14:10:34 AbstractAlignmentMerger Merged 9,000,000 records. Elapsed time: 01:00:07s. Time for last 1,000,000: 9s. Last read position: NC_000010.11:22,931,933
INFO 2021-09-21 14:10:43 AbstractAlignmentMerger Merged 10,000,000 records. Elapsed time: 01:00:15s. Time for last 1,000,000: 8s. Last read position: NC_000019.10:43,848,554
INFO 2021-09-21 14:10:51 AbstractAlignmentMerger Merged 11,000,000 records. Elapsed time: 01:00:24s. Time for last 1,000,000: 8s. Last read position: NC_000018.10:53,391,805
INFO 2021-09-21 14:11:00 AbstractAlignmentMerger Merged 12,000,000 records. Elapsed time: 01:00:32s. Time for last 1,000,000: 8s. Last read position: NC_000002.12:66,512,430
WARNING 2021-09-21 14:11:05 AbstractAlignmentMerger Record contains no unclipped bases; making unmapped: A00684:110:H2TYCDMXY:1:1203:18258:24408 1/2 101b aligned read.
INFO 2021-09-21 14:11:09 AbstractAlignmentMerger Merged 13,000,000 records. Elapsed time: 01:00:41s. Time for last 1,000,000: 8s. Last read position: NC_000019.10:40,377,551
INFO 2021-09-21 14:11:17 AbstractAlignmentMerger Merged 14,000,000 records. Elapsed time: 01:00:49s. Time for last 1,000,000: 8s. Last read position: NC_000017.11:80,348,029
INFO 2021-09-21 14:11:26 AbstractAlignmentMerger Merged 15,000,000 records. Elapsed time: 01:00:58s. Time for last 1,000,000: 9s. Last read position: NC_000001.11:166,796,659
INFO 2021-09-21 14:11:35 AbstractAlignmentMerger Merged 16,000,000 records. Elapsed time: 01:01:07s. Time for last 1,000,000: 8s. Last read position: NC_000006.12:149,676,428
INFO 2021-09-21 14:11:43 AbstractAlignmentMerger Merged 17,000,000 records. Elapsed time: 01:01:15s. Time for last 1,000,000: 8s. Last read position: NC_000005.10:168,190,336
INFO 2021-09-21 14:11:51 AbstractAlignmentMerger Merged 18,000,000 records. Elapsed time: 01:01:24s. Time for last 1,000,000: 8s. Last read position: NC_000007.14:105,203,765
INFO 2021-09-21 14:12:00 AbstractAlignmentMerger Merged 19,000,000 records. Elapsed time: 01:01:32s. Time for last 1,000,000: 8s. Last read position: NC_000008.11:144,110,404
INFO 2021-09-21 14:12:08 AbstractAlignmentMerger Merged 20,000,000 records. Elapsed time: 01:01:41s. Time for last 1,000,000: 8s. Last read position: NC_000002.12:232,551,294
INFO 2021-09-21 14:12:16 AbstractAlignmentMerger Merged 21,000,000 records. Elapsed time: 01:01:49s. Time for last 1,000,000: 8s. Last read position: NC_000023.11:53,544,554
INFO 2021-09-21 14:12:25 AbstractAlignmentMerger Merged 22,000,000 records. Elapsed time: 01:01:57s. Time for last 1,000,000: 8s. Last read position: NC_000019.10:13,277,009
INFO 2021-09-21 14:12:33 AbstractAlignmentMerger Merged 23,000,000 records. Elapsed time: 01:02:05s. Time for last 1,000,000: 8s. Last read position: NC_000002.12:232,329,857
INFO 2021-09-21 14:12:43 AbstractAlignmentMerger Merged 24,000,000 records. Elapsed time: 01:02:15s. Time for last 1,000,000: 9s. Last read position: NC_000019.10:14,152,057
INFO 2021-09-21 14:12:51 AbstractAlignmentMerger Merged 25,000,000 records. Elapsed time: 01:02:24s. Time for last 1,000,000: 8s. Last read position: NC_000022.11:46,350,506
INFO 2021-09-21 14:13:00 AbstractAlignmentMerger Merged 26,000,000 records. Elapsed time: 01:02:32s. Time for last 1,000,000: 8s. Last read position: NC_000015.10:45,097,227
INFO 2021-09-21 14:13:08 AbstractAlignmentMerger Merged 27,000,000 records. Elapsed time: 01:02:41s. Time for last 1,000,000: 8s. Last read position: NC_000011.10:125,079,710
INFO 2021-09-21 14:13:16 AbstractAlignmentMerger Merged 28,000,000 records. Elapsed time: 01:02:49s. Time for last 1,000,000: 8s. Last read position: NC_000022.11:32,191,122
INFO 2021-09-21 14:13:24 AbstractAlignmentMerger Merged 29,000,000 records. Elapsed time: 01:02:57s. Time for last 1,000,000: 8s. Last read position: NC_000001.11:155,709,754
INFO 2021-09-21 14:13:33 AbstractAlignmentMerger Merged 30,000,000 records. Elapsed time: 01:03:06s. Time for last 1,000,000: 9s. Last read position: NC_000004.12:6,292,044
INFO 2021-09-21 14:13:42 AbstractAlignmentMerger Merged 31,000,000 records. Elapsed time: 01:03:14s. Time for last 1,000,000: 8s. Last read position: NC_000001.11:228,321,950
INFO 2021-09-21 14:13:51 AbstractAlignmentMerger Merged 32,000,000 records. Elapsed time: 01:03:23s. Time for last 1,000,000: 9s. Last read position: NC_000021.9:41,828,205
INFO 2021-09-21 14:14:00 AbstractAlignmentMerger Merged 33,000,000 records. Elapsed time: 01:03:33s. Time for last 1,000,000: 9s. Last read position: NC_000015.10:75,368,173
INFO 2021-09-21 14:14:09 AbstractAlignmentMerger Merged 34,000,000 records. Elapsed time: 01:03:42s. Time for last 1,000,000: 9s. Last read position: NC_000002.12:237,714,063
INFO 2021-09-21 14:14:17 AbstractAlignmentMerger Merged 35,000,000 records. Elapsed time: 01:03:50s. Time for last 1,000,000: 8s. Last read position: NC_000015.10:80,921,030
INFO 2021-09-21 14:14:26 AbstractAlignmentMerger Merged 36,000,000 records. Elapsed time: 01:03:58s. Time for last 1,000,000: 8s. Last read position: NC_000007.14:128,330,700
INFO 2021-09-21 14:14:34 AbstractAlignmentMerger Merged 37,000,000 records. Elapsed time: 01:04:07s. Time for last 1,000,000: 8s. Last read position: NC_000002.12:27,038,440
INFO 2021-09-21 14:14:42 AbstractAlignmentMerger Merged 38,000,000 records. Elapsed time: 01:04:15s. Time for last 1,000,000: 8s. Last read position: NC_000005.10:109,378,300
INFO 2021-09-21 14:14:51 AbstractAlignmentMerger Merged 39,000,000 records. Elapsed time: 01:04:24s. Time for last 1,000,000: 8s. Last read position: NC_000010.11:133,168,238
INFO 2021-09-21 14:15:00 AbstractAlignmentMerger Merged 40,000,000 records. Elapsed time: 01:04:32s. Time for last 1,000,000: 8s. Last read position: NC_000001.11:207,657,245
INFO 2021-09-21 14:15:08 AbstractAlignmentMerger Merged 41,000,000 records. Elapsed time: 01:04:41s. Time for last 1,000,000: 8s. Last read position: NC_000001.11:143,203,351
INFO 2021-09-21 14:15:16 AbstractAlignmentMerger Merged 42,000,000 records. Elapsed time: 01:04:49s. Time for last 1,000,000: 8s. Last read position: NC_000003.12:68,978,336
INFO 2021-09-21 14:15:25 AbstractAlignmentMerger Merged 43,000,000 records. Elapsed time: 01:04:58s. Time for last 1,000,000: 8s. Last read position: NC_000019.10:12,551,225
INFO 2021-09-21 14:15:34 AbstractAlignmentMerger Merged 44,000,000 records. Elapsed time: 01:05:06s. Time for last 1,000,000: 8s. Last read position: NC_000018.10:5,443,874
INFO 2021-09-21 14:15:44 AbstractAlignmentMerger Merged 45,000,000 records. Elapsed time: 01:05:16s. Time for last 1,000,000: 9s. Last read position: NC_000017.11:13,813,251
INFO 2021-09-21 14:15:52 AbstractAlignmentMerger Merged 46,000,000 records. Elapsed time: 01:05:25s. Time for last 1,000,000: 8s. Last read position: NC_000009.12:37,478,011
INFO 2021-09-21 14:16:00 AbstractAlignmentMerger Merged 47,000,000 records. Elapsed time: 01:05:33s. Time for last 1,000,000: 8s. Last read position: NC_000001.11:23,441,125
INFO 2021-09-21 14:16:09 AbstractAlignmentMerger Merged 48,000,000 records. Elapsed time: 01:05:41s. Time for last 1,000,000: 8s. Last read position: NC_000017.11:39,606,380
INFO 2021-09-21 14:16:17 AbstractAlignmentMerger Merged 49,000,000 records. Elapsed time: 01:05:49s. Time for last 1,000,000: 8s. Last read position: NC_000010.11:68,415,040
INFO 2021-09-21 14:16:25 AbstractAlignmentMerger Merged 50,000,000 records. Elapsed time: 01:05:58s. Time for last 1,000,000: 8s. Last read position: NC_000004.12:2,700,357
INFO 2021-09-21 14:16:33 AbstractAlignmentMerger Merged 51,000,000 records. Elapsed time: 01:06:06s. Time for last 1,000,000: 8s. Last read position: NC_000006.12:158,069,496
INFO 2021-09-21 14:16:41 AbstractAlignmentMerger Merged 52,000,000 records. Elapsed time: 01:06:14s. Time for last 1,000,000: 8s. Last read position: NC_000023.11:135,547,108
INFO 2021-09-21 14:16:50 AbstractAlignmentMerger Merged 53,000,000 records. Elapsed time: 01:06:23s. Time for last 1,000,000: 9s. Last read position: NC_000003.12:75,669,276
INFO 2021-09-21 14:16:59 AbstractAlignmentMerger Merged 54,000,000 records. Elapsed time: 01:06:32s. Time for last 1,000,000: 8s. Last read position: NC_000008.11:23,568,325
INFO 2021-09-21 14:17:08 AbstractAlignmentMerger Merged 55,000,000 records. Elapsed time: 01:06:41s. Time for last 1,000,000: 9s. Last read position: NC_000005.10:33,668,709
INFO 2021-09-21 14:17:16 AbstractAlignmentMerger Merged 56,000,000 records. Elapsed time: 01:06:49s. Time for last 1,000,000: 8s. Last read position: NC_000004.12:41,982,377
INFO 2021-09-21 14:17:26 AbstractAlignmentMerger Merged 57,000,000 records. Elapsed time: 01:06:59s. Time for last 1,000,000: 9s. Last read position: NT_187508.1:41,585
INFO 2021-09-21 14:17:34 AbstractAlignmentMerger Merged 58,000,000 records. Elapsed time: 01:07:07s. Time for last 1,000,000: 8s. Last read position: NC_000022.11:50,080,454
INFO 2021-09-21 14:17:42 AbstractAlignmentMerger Merged 59,000,000 records. Elapsed time: 01:07:15s. Time for last 1,000,000: 7s. Last read position: NC_000015.10:94,033,918
INFO 2021-09-21 14:17:51 AbstractAlignmentMerger Merged 60,000,000 records. Elapsed time: 01:07:23s. Time for last 1,000,000: 8s. Last read position: NC_000019.10:1,373,026
INFO 2021-09-21 14:17:59 AbstractAlignmentMerger Merged 61,000,000 records. Elapsed time: 01:07:31s. Time for last 1,000,000: 8s. Last read position: NC_000018.10:22,416,409
INFO 2021-09-21 14:18:07 AbstractAlignmentMerger Merged 62,000,000 records. Elapsed time: 01:07:40s. Time for last 1,000,000: 8s. Last read position: NC_000007.14:151,076,966
INFO 2021-09-21 14:18:16 AbstractAlignmentMerger Merged 63,000,000 records. Elapsed time: 01:07:48s. Time for last 1,000,000: 8s. Last read position: NC_000002.12:233,729,235
INFO 2021-09-21 14:18:24 AbstractAlignmentMerger Merged 64,000,000 records. Elapsed time: 01:07:57s. Time for last 1,000,000: 8s. Last read position: NC_000010.11:96,609,919
INFO 2021-09-21 14:18:32 AbstractAlignmentMerger Merged 65,000,000 records. Elapsed time: 01:08:05s. Time for last 1,000,000: 8s. Last read position: NC_000007.14:5,501,006
INFO 2021-09-21 14:18:41 AbstractAlignmentMerger Merged 66,000,000 records. Elapsed time: 01:08:14s. Time for last 1,000,000: 8s. Last read position: NC_000003.12:184,711,586
INFO 2021-09-21 14:18:49 AbstractAlignmentMerger Merged 67,000,000 records. Elapsed time: 01:08:22s. Time for last 1,000,000: 8s. Last read position: NC_000016.10:70,512,191
INFO 2021-09-21 14:18:59 AbstractAlignmentMerger Merged 68,000,000 records. Elapsed time: 01:08:32s. Time for last 1,000,000: 9s. Last read position: NC_000016.10:58,679,755
INFO 2021-09-21 14:19:07 AbstractAlignmentMerger Merged 69,000,000 records. Elapsed time: 01:08:40s. Time for last 1,000,000: 8s. Last read position: NC_000007.14:130,192,818
INFO 2021-09-21 14:19:17 AbstractAlignmentMerger Merged 70,000,000 records. Elapsed time: 01:08:49s. Time for last 1,000,000: 9s. Last read position: NC_000020.11:1,312,558
INFO 2021-09-21 14:19:26 AbstractAlignmentMerger Merged 71,000,000 records. Elapsed time: 01:08:58s. Time for last 1,000,000: 9s. Last read position: NC_000007.14:7,234,226
INFO 2021-09-21 14:19:34 AbstractAlignmentMerger Merged 72,000,000 records. Elapsed time: 01:09:07s. Time for last 1,000,000: 8s. Last read position: NC_000009.12:42,656,755
INFO 2021-09-21 14:19:43 AbstractAlignmentMerger Merged 73,000,000 records. Elapsed time: 01:09:15s. Time for last 1,000,000: 8s. Last read position: NC_000019.10:9,413,469
INFO 2021-09-21 14:19:51 AbstractAlignmentMerger Merged 74,000,000 records. Elapsed time: 01:09:23s. Time for last 1,000,000: 8s. Last read position: NC_000010.11:86,692,064
INFO 2021-09-21 14:19:59 AbstractAlignmentMerger Merged 75,000,000 records. Elapsed time: 01:09:31s. Time for last 1,000,000: 8s. Last read position: NC_000010.11:132,405,043
INFO 2021-09-21 14:20:07 AbstractAlignmentMerger Merged 76,000,000 records. Elapsed time: 01:09:40s. Time for last 1,000,000: 8s. Last read position: NC_000004.12:86,575,697
INFO 2021-09-21 14:20:16 AbstractAlignmentMerger Merged 77,000,000 records. Elapsed time: 01:09:48s. Time for last 1,000,000: 8s. Last read position: NC_000004.12:56,401,997
INFO 2021-09-21 14:20:24 AbstractAlignmentMerger Merged 78,000,000 records. Elapsed time: 01:09:57s. Time for last 1,000,000: 8s. Last read position: NC_000002.12:127,307,733
INFO 2021-09-21 14:20:32 AbstractAlignmentMerger Merged 79,000,000 records. Elapsed time: 01:10:05s. Time for last 1,000,000: 8s. Last read position: NC_000008.11:81,808,497
INFO 2021-09-21 14:20:42 AbstractAlignmentMerger Merged 80,000,000 records. Elapsed time: 01:10:14s. Time for last 1,000,000: 9s. Last read position: NC_000023.11:119,693,134
INFO 2021-09-21 14:20:50 AbstractAlignmentMerger Merged 81,000,000 records. Elapsed time: 01:10:22s. Time for last 1,000,000: 7s. Last read position: NW_021160005.1:123,056
INFO 2021-09-21 14:20:58 AbstractAlignmentMerger Merged 82,000,000 records. Elapsed time: 01:10:30s. Time for last 1,000,000: 7s. Last read position: NC_000002.12:54,966,998
INFO 2021-09-21 14:21:06 AbstractAlignmentMerger Merged 83,000,000 records. Elapsed time: 01:10:38s. Time for last 1,000,000: 8s. Last read position: NC_000001.11:152,216,136
INFO 2021-09-21 14:21:14 AbstractAlignmentMerger Merged 84,000,000 records. Elapsed time: 01:10:46s. Time for last 1,000,000: 7s. Last read position: NC_000023.11:48,571,508
INFO 2021-09-21 14:21:22 AbstractAlignmentMerger Merged 85,000,000 records. Elapsed time: 01:10:55s. Time for last 1,000,000: 8s. Last read position: NC_000006.12:160,096,407
INFO 2021-09-21 14:21:30 AbstractAlignmentMerger Merged 86,000,000 records. Elapsed time: 01:11:03s. Time for last 1,000,000: 8s. Last read position: NC_000015.10:99,829,448
INFO 2021-09-21 14:21:39 AbstractAlignmentMerger Merged 87,000,000 records. Elapsed time: 01:11:11s. Time for last 1,000,000: 8s. Last read position: NC_000017.11:28,701,404
INFO 2021-09-21 14:21:47 AbstractAlignmentMerger Merged 88,000,000 records. Elapsed time: 01:11:19s. Time for last 1,000,000: 8s. Last read position: NC_000001.11:12,276,582
INFO 2021-09-21 14:21:56 AbstractAlignmentMerger Merged 89,000,000 records. Elapsed time: 01:11:28s. Time for last 1,000,000: 9s. Last read position: NC_000023.11:102,654,001
INFO 2021-09-21 14:22:04 AbstractAlignmentMerger Merged 90,000,000 records. Elapsed time: 01:11:37s. Time for last 1,000,000: 8s. Last read position: NC_000001.11:33,368,738
INFO 2021-09-21 14:22:14 AbstractAlignmentMerger Merged 91,000,000 records. Elapsed time: 01:11:46s. Time for last 1,000,000: 9s. Last read position: NC_000012.12:42,235,961
INFO 2021-09-21 14:22:22 AbstractAlignmentMerger Merged 92,000,000 records. Elapsed time: 01:11:55s. Time for last 1,000,000: 8s. Last read position: NC_000006.12:86,652,389
INFO 2021-09-21 14:22:30 AbstractAlignmentMerger Merged 93,000,000 records. Elapsed time: 01:12:03s. Time for last 1,000,000: 8s. Last read position: NC_000023.11:83,558,920
INFO 2021-09-21 14:22:39 AbstractAlignmentMerger Merged 94,000,000 records. Elapsed time: 01:12:12s. Time for last 1,000,000: 8s. Last read position: NC_000014.9:69,768,776
INFO 2021-09-21 14:22:48 AbstractAlignmentMerger Merged 95,000,000 records. Elapsed time: 01:12:21s. Time for last 1,000,000: 8s. Last read position: NC_000004.12:183,444,804
INFO 2021-09-21 14:22:56 AbstractAlignmentMerger Merged 96,000,000 records. Elapsed time: 01:12:29s. Time for last 1,000,000: 8s. Last read position: NC_000005.10:138,140,062
INFO 2021-09-21 14:23:05 AbstractAlignmentMerger Merged 97,000,000 records. Elapsed time: 01:12:37s. Time for last 1,000,000: 8s. Last read position: NC_000001.11:54,807,186
INFO 2021-09-21 14:23:13 AbstractAlignmentMerger Merged 98,000,000 records. Elapsed time: 01:12:46s. Time for last 1,000,000: 8s. Last read position: NC_000019.10:991,248
INFO 2021-09-21 14:23:22 AbstractAlignmentMerger Merged 99,000,000 records. Elapsed time: 01:12:55s. Time for last 1,000,000: 9s. Last read position: NC_000024.10:291,702
INFO 2021-09-21 14:23:31 AbstractAlignmentMerger Merged 100,000,000 records. Elapsed time: 01:13:04s. Time for last 1,000,000: 8s. Last read position: NC_000016.10:83,908,403
INFO 2021-09-21 14:23:41 AbstractAlignmentMerger Merged 101,000,000 records. Elapsed time: 01:13:13s. Time for last 1,000,000: 9s. Last read position: NC_000019.10:14,941,954
INFO 2021-09-21 14:23:49 AbstractAlignmentMerger Merged 102,000,000 records. Elapsed time: 01:13:21s. Time for last 1,000,000: 8s. Last read position: NC_000008.11:138,153,039
INFO 2021-09-21 14:23:57 AbstractAlignmentMerger Merged 103,000,000 records. Elapsed time: 01:13:29s. Time for last 1,000,000: 7s. Last read position: NC_000012.12:112,950,672
INFO 2021-09-21 14:24:05 AbstractAlignmentMerger Merged 104,000,000 records. Elapsed time: 01:13:38s. Time for last 1,000,000: 8s. Last read position: NC_000005.10:68,293,317
INFO 2021-09-21 14:24:14 AbstractAlignmentMerger Merged 105,000,000 records. Elapsed time: 01:13:46s. Time for last 1,000,000: 8s. Last read position: NC_000007.14:136,262,858
WARNING 2021-09-21 14:24:19 AbstractAlignmentMerger Record contains no unclipped bases; making unmapped: A00684:110:H2TYCDMXY:2:1150:23113:9330 1/2 101b aligned read.
INFO 2021-09-21 14:24:22 AbstractAlignmentMerger Merged 106,000,000 records. Elapsed time: 01:13:55s. Time for last 1,000,000: 8s. Last read position: NC_000021.9:39,202,335
INFO 2021-09-21 14:24:31 AbstractAlignmentMerger Merged 107,000,000 records. Elapsed time: 01:14:03s. Time for last 1,000,000: 8s. Last read position: NC_000008.11:99,699,681
INFO 2021-09-21 14:24:40 AbstractAlignmentMerger Merged 108,000,000 records. Elapsed time: 01:14:12s. Time for last 1,000,000: 8s. Last read position: NC_000005.10:56,276,085
INFO 2021-09-21 14:24:48 AbstractAlignmentMerger Merged 109,000,000 records. Elapsed time: 01:14:21s. Time for last 1,000,000: 8s. Last read position: NC_000008.11:144,103,736
INFO 2021-09-21 14:24:57 AbstractAlignmentMerger Merged 110,000,000 records. Elapsed time: 01:14:30s. Time for last 1,000,000: 9s. Last read position: NT_187614.1:2,753,310
INFO 2021-09-21 14:25:05 AbstractAlignmentMerger Merged 111,000,000 records. Elapsed time: 01:14:38s. Time for last 1,000,000: 8s. Last read position: NC_000002.12:129,980,735
INFO 2021-09-21 14:25:15 AbstractAlignmentMerger Merged 112,000,000 records. Elapsed time: 01:14:47s. Time for last 1,000,000: 9s. Last read position: NC_000005.10:140,632,092
INFO 2021-09-21 14:25:23 AbstractAlignmentMerger Merged 113,000,000 records. Elapsed time: 01:14:55s. Time for last 1,000,000: 7s. Last read position: NC_000003.12:184,353,355
INFO 2021-09-21 14:25:31 AbstractAlignmentMerger Merged 114,000,000 records. Elapsed time: 01:15:04s. Time for last 1,000,000: 8s. Last read position: NC_000014.9:100,276,390
INFO 2021-09-21 14:25:39 AbstractAlignmentMerger Merged 115,000,000 records. Elapsed time: 01:15:12s. Time for last 1,000,000: 8s. Last read position: NC_000002.12:9,388,499
INFO 2021-09-21 14:25:48 AbstractAlignmentMerger Merged 116,000,000 records. Elapsed time: 01:15:20s. Time for last 1,000,000: 8s. Last read position: NC_000002.12:97,558,823
INFO 2021-09-21 14:25:56 AbstractAlignmentMerger Merged 117,000,000 records. Elapsed time: 01:15:28s. Time for last 1,000,000: 8s. Last read position: NC_000010.11:35,071,151
INFO 2021-09-21 14:26:04 AbstractAlignmentMerger Merged 118,000,000 records. Elapsed time: 01:15:37s. Time for last 1,000,000: 8s. Last read position: NC_000009.12:109,108,521
INFO 2021-09-21 14:26:12 AbstractAlignmentMerger Merged 119,000,000 records. Elapsed time: 01:15:45s. Time for last 1,000,000: 7s. Last read position: NC_000001.11:202,203,876
INFO 2021-09-21 14:26:21 AbstractAlignmentMerger Merged 120,000,000 records. Elapsed time: 01:15:54s. Time for last 1,000,000: 8s. Last read position: NC_000012.12:52,749,289
INFO 2021-09-21 14:26:29 AbstractAlignmentMerger Merged 121,000,000 records. Elapsed time: 01:16:02s. Time for last 1,000,000: 8s. Last read position: NC_000002.12:178,582,010
INFO 2021-09-21 14:26:38 AbstractAlignmentMerger Merged 122,000,000 records. Elapsed time: 01:16:11s. Time for last 1,000,000: 9s. Last read position: NC_000023.11:55,002,868
INFO 2021-09-21 14:26:47 AbstractAlignmentMerger Merged 123,000,000 records. Elapsed time: 01:16:19s. Time for last 1,000,000: 8s. Last read position: NW_011332701.1:694,892
INFO 2021-09-21 14:26:56 AbstractAlignmentMerger Merged 124,000,000 records. Elapsed time: 01:16:29s. Time for last 1,000,000: 9s. Last read position: NC_000001.11:35,894,022
INFO 2021-09-21 14:27:04 AbstractAlignmentMerger Merged 125,000,000 records. Elapsed time: 01:16:37s. Time for last 1,000,000: 7s. Last read position: NC_000016.10:78,049,086
INFO 2021-09-21 14:27:12 AbstractAlignmentMerger Merged 126,000,000 records. Elapsed time: 01:16:44s. Time for last 1,000,000: 7s. Last read position: NC_000003.12:185,657,346
INFO 2021-09-21 14:27:20 AbstractAlignmentMerger Merged 127,000,000 records. Elapsed time: 01:16:53s. Time for last 1,000,000: 8s. Last read position: NC_000001.11:75,744,022
INFO 2021-09-21 14:27:28 AbstractAlignmentMerger Merged 128,000,000 records. Elapsed time: 01:17:01s. Time for last 1,000,000: 7s. Last read position: NC_000017.11:35,911,390
INFO 2021-09-21 14:27:37 AbstractAlignmentMerger Merged 129,000,000 records. Elapsed time: 01:17:10s. Time for last 1,000,000: 8s. Last read position: NW_003315959.1:53,766
INFO 2021-09-21 14:27:46 AbstractAlignmentMerger Merged 130,000,000 records. Elapsed time: 01:17:19s. Time for last 1,000,000: 8s. Last read position: NC_000002.12:237,566,538
INFO 2021-09-21 14:27:55 AbstractAlignmentMerger Merged 131,000,000 records. Elapsed time: 01:17:27s. Time for last 1,000,000: 8s. Last read position: NC_000018.10:67,127,814
INFO 2021-09-21 14:28:03 AbstractAlignmentMerger Merged 132,000,000 records. Elapsed time: 01:17:35s. Time for last 1,000,000: 8s. Last read position: NC_000006.12:41,336,701
INFO 2021-09-21 14:28:12 AbstractAlignmentMerger Merged 133,000,000 records. Elapsed time: 01:17:45s. Time for last 1,000,000: 9s. Last read position: NC_000003.12:56,729,516
INFO 2021-09-21 14:28:20 AbstractAlignmentMerger Merged 134,000,000 records. Elapsed time: 01:17:53s. Time for last 1,000,000: 8s. Last read position: NC_000019.10:1,088,753
INFO 2021-09-21 14:28:30 AbstractAlignmentMerger Merged 135,000,000 records. Elapsed time: 01:18:03s. Time for last 1,000,000: 10s. Last read position: NC_000012.12:65,646,050
INFO 2021-09-21 14:28:39 AbstractAlignmentMerger Merged 136,000,000 records. Elapsed time: 01:18:12s. Time for last 1,000,000: 8s. Last read position: NC_000004.12:88,697,387
INFO 2021-09-21 14:28:47 AbstractAlignmentMerger Merged 137,000,000 records. Elapsed time: 01:18:20s. Time for last 1,000,000: 8s. Last read position: NC_000006.12:167,180,593
INFO 2021-09-21 14:28:55 AbstractAlignmentMerger Merged 138,000,000 records. Elapsed time: 01:18:28s. Time for last 1,000,000: 7s. Last read position: NC_000019.10:7,038,369
WARNING 2021-09-21 14:29:01 AbstractAlignmentMerger Record contains no unclipped bases; making unmapped: A00684:110:H2TYCDMXY:2:1420:16604:16313 1/2 101b aligned read.
INFO 2021-09-21 14:29:03 AbstractAlignmentMerger Merged 139,000,000 records. Elapsed time: 01:18:36s. Time for last 1,000,000: 8s. Last read position: NC_000023.11:132,214,388
INFO 2021-09-21 14:29:11 AbstractAlignmentMerger Merged 140,000,000 records. Elapsed time: 01:18:44s. Time for last 1,000,000: 8s. Last read position: NC_000005.10:76,631,904
INFO 2021-09-21 14:29:20 AbstractAlignmentMerger Merged 141,000,000 records. Elapsed time: 01:18:52s. Time for last 1,000,000: 8s. Last read position: NC_000017.11:32,362,953
INFO 2021-09-21 14:29:28 AbstractAlignmentMerger Merged 142,000,000 records. Elapsed time: 01:19:01s. Time for last 1,000,000: 8s. Last read position: NC_000023.11:54,237,359
INFO 2021-09-21 14:29:37 AbstractAlignmentMerger Merged 143,000,000 records. Elapsed time: 01:19:10s. Time for last 1,000,000: 9s. Last read position: NC_000023.11:40,073,279
INFO 2021-09-21 14:29:46 AbstractAlignmentMerger Merged 144,000,000 records. Elapsed time: 01:19:18s. Time for last 1,000,000: 8s. Last read position: NC_000009.12:97,854,188
INFO 2021-09-21 14:29:55 AbstractAlignmentMerger Merged 145,000,000 records. Elapsed time: 01:19:27s. Time for last 1,000,000: 9s. Last read position: NC_000009.12:127,213,026
INFO 2021-09-21 14:30:03 AbstractAlignmentMerger Merged 146,000,000 records. Elapsed time: 01:19:35s. Time for last 1,000,000: 7s. Last read position: NC_000009.12:32,973,571
INFO 2021-09-21 14:30:11 AbstractAlignmentMerger Merged 147,000,000 records. Elapsed time: 01:19:43s. Time for last 1,000,000: 7s. Last read position: NC_000016.10:67,203,016
INFO 2021-09-21 14:30:18 AbstractAlignmentMerger Merged 148,000,000 records. Elapsed time: 01:19:51s. Time for last 1,000,000: 7s. Last read position: NC_000002.12:97,725,039
INFO 2021-09-21 14:30:26 AbstractAlignmentMerger Merged 149,000,000 records. Elapsed time: 01:19:59s. Time for last 1,000,000: 7s. Last read position: NC_000022.11:28,701,421
INFO 2021-09-21 14:30:35 AbstractAlignmentMerger Merged 150,000,000 records. Elapsed time: 01:20:07s. Time for last 1,000,000: 8s. Last read position: NC_000001.11:3,763,291
INFO 2021-09-21 14:30:43 AbstractAlignmentMerger Merged 151,000,000 records. Elapsed time: 01:20:15s. Time for last 1,000,000: 7s. Last read position: NC_000012.12:35,232,074
INFO 2021-09-21 14:30:51 AbstractAlignmentMerger Merged 152,000,000 records. Elapsed time: 01:20:23s. Time for last 1,000,000: 8s. Last read position: NC_000019.10:52,817,796
INFO 2021-09-21 14:30:59 AbstractAlignmentMerger Merged 153,000,000 records. Elapsed time: 01:20:32s. Time for last 1,000,000: 8s. Last read position: NC_000007.14:95,424,444
INFO 2021-09-21 14:31:08 AbstractAlignmentMerger Merged 154,000,000 records. Elapsed time: 01:20:40s. Time for last 1,000,000: 8s. Last read position: NW_012132914.1:61,547
INFO 2021-09-21 14:31:16 AbstractAlignmentMerger Merged 155,000,000 records. Elapsed time: 01:20:48s. Time for last 1,000,000: 7s. Last read position: NC_000016.10:8,901,342
INFO 2021-09-21 14:31:24 AbstractAlignmentMerger Merged 156,000,000 records. Elapsed time: 01:20:57s. Time for last 1,000,000: 8s. Last read position: NW_021160017.1:2,639,877
INFO 2021-09-21 14:31:32 AbstractAlignmentMerger Merged 157,000,000 records. Elapsed time: 01:21:05s. Time for last 1,000,000: 7s. Last read position: NC_000001.11:228,101,943
INFO 2021-09-21 14:31:42 AbstractAlignmentMerger Merged 158,000,000 records. Elapsed time: 01:21:15s. Time for last 1,000,000: 9s. Last read position: NT_167249.2:3,293,604
INFO 2021-09-21 14:31:51 AbstractAlignmentMerger Merged 159,000,000 records. Elapsed time: 01:21:23s. Time for last 1,000,000: 8s. Last read position: NC_000015.10:52,147,371
INFO 2021-09-21 14:31:58 AbstractAlignmentMerger Merged 160,000,000 records. Elapsed time: 01:21:31s. Time for last 1,000,000: 7s. Last read position: NC_000008.11:109,518,288
INFO 2021-09-21 14:32:06 AbstractAlignmentMerger Merged 161,000,000 records. Elapsed time: 01:21:39s. Time for last 1,000,000: 7s. Last read position: NC_000020.11:1,127,475
INFO 2021-09-21 14:32:14 AbstractAlignmentMerger Merged 162,000,000 records. Elapsed time: 01:21:47s. Time for last 1,000,000: 8s. Last read position: NC_000010.11:73,712,214
INFO 2021-09-21 14:32:22 AbstractAlignmentMerger Merged 163,000,000 records. Elapsed time: 01:21:55s. Time for last 1,000,000: 7s. Last read position: NC_000004.12:55,035,690
INFO 2021-09-21 14:32:30 AbstractAlignmentMerger Merged 164,000,000 records. Elapsed time: 01:22:03s. Time for last 1,000,000: 8s. Last read position: NC_000001.11:152,216,475
INFO 2021-09-21 14:32:38 AbstractAlignmentMerger Merged 165,000,000 records. Elapsed time: 01:22:11s. Time for last 1,000,000: 8s. Last read position: NC_000001.11:201,066,283
INFO 2021-09-21 14:32:47 AbstractAlignmentMerger Merged 166,000,000 records. Elapsed time: 01:22:19s. Time for last 1,000,000: 8s. Last read position: NC_000011.10:62,521,837
INFO 2021-09-21 14:32:55 AbstractAlignmentMerger Merged 167,000,000 records. Elapsed time: 01:22:28s. Time for last 1,000,000: 8s. Last read position: NC_000002.12:96,351,961
INFO 2021-09-21 14:33:04 AbstractAlignmentMerger Merged 168,000,000 records. Elapsed time: 01:22:37s. Time for last 1,000,000: 9s. Last read position: NC_000008.11:143,808,862
INFO 2021-09-21 14:33:12 AbstractAlignmentMerger Merged 169,000,000 records. Elapsed time: 01:22:45s. Time for last 1,000,000: 7s. Last read position: NC_000002.12:29,181,760
INFO 2021-09-21 14:33:22 AbstractAlignmentMerger Merged 170,000,000 records. Elapsed time: 01:22:54s. Time for last 1,000,000: 9s. Last read position: NC_000002.12:112,721,082
INFO 2021-09-21 14:33:31 AbstractAlignmentMerger Merged 171,000,000 records. Elapsed time: 01:23:03s. Time for last 1,000,000: 9s. Last read position: NC_000009.12:136,792,131
INFO 2021-09-21 14:33:39 AbstractAlignmentMerger Merged 172,000,000 records. Elapsed time: 01:23:11s. Time for last 1,000,000: 8s. Last read position: NC_000016.10:90,009,371
INFO 2021-09-21 14:33:46 AbstractAlignmentMerger Merged 173,000,000 records. Elapsed time: 01:23:19s. Time for last 1,000,000: 7s. Last read position: NC_000004.12:2,939,658
INFO 2021-09-21 14:33:54 AbstractAlignmentMerger Merged 174,000,000 records. Elapsed time: 01:23:26s. Time for last 1,000,000: 7s. Last read position: NC_000009.12:111,780,925
INFO 2021-09-21 14:34:02 AbstractAlignmentMerger Merged 175,000,000 records. Elapsed time: 01:23:34s. Time for last 1,000,000: 7s. Last read position: NC_000019.10:45,816,268
INFO 2021-09-21 14:34:09 AbstractAlignmentMerger Merged 176,000,000 records. Elapsed time: 01:23:42s. Time for last 1,000,000: 7s. Last read position: NC_000009.12:128,103,684
INFO 2021-09-21 14:34:18 AbstractAlignmentMerger Merged 177,000,000 records. Elapsed time: 01:23:50s. Time for last 1,000,000: 8s. Last read position: NC_000004.12:76,089,565
INFO 2021-09-21 14:34:25 AbstractAlignmentMerger Merged 178,000,000 records. Elapsed time: 01:23:58s. Time for last 1,000,000: 7s. Last read position: NC_000005.10:81,251,029
INFO 2021-09-21 14:34:34 AbstractAlignmentMerger Merged 179,000,000 records. Elapsed time: 01:24:06s. Time for last 1,000,000: 8s. Last read position: NC_000003.12:126,654,787
INFO 2021-09-21 14:34:42 AbstractAlignmentMerger Merged 180,000,000 records. Elapsed time: 01:24:15s. Time for last 1,000,000: 8s. Last read position: NT_187553.1:127,698
INFO 2021-09-21 14:34:51 AbstractAlignmentMerger Merged 181,000,000 records. Elapsed time: 01:24:24s. Time for last 1,000,000: 8s. Last read position: NC_000002.12:108,675,961
INFO 2021-09-21 14:34:58 AbstractAlignmentMerger Merged 182,000,000 records. Elapsed time: 01:24:31s. Time for last 1,000,000: 7s. Last read position: NC_000005.10:139,956,249
INFO 2021-09-21 14:35:06 AbstractAlignmentMerger Merged 183,000,000 records. Elapsed time: 01:24:39s. Time for last 1,000,000: 7s. Last read position: NC_000002.12:55,435,393
INFO 2021-09-21 14:35:14 AbstractAlignmentMerger Merged 184,000,000 records. Elapsed time: 01:24:47s. Time for last 1,000,000: 7s. Last read position: NC_000019.10:46,160,494
INFO 2021-09-21 14:35:22 AbstractAlignmentMerger Merged 185,000,000 records. Elapsed time: 01:24:54s. Time for last 1,000,000: 7s. Last read position: NC_000021.9:42,691,462
INFO 2021-09-21 14:35:30 AbstractAlignmentMerger Merged 186,000,000 records. Elapsed time: 01:25:02s. Time for last 1,000,000: 7s. Last read position: NC_000001.11:31,619,529
INFO 2021-09-21 14:35:38 AbstractAlignmentMerger Merged 187,000,000 records. Elapsed time: 01:25:10s. Time for last 1,000,000: 7s. Last read position: NC_000007.14:56,055,619
INFO 2021-09-21 14:35:45 AbstractAlignmentMerger Merged 188,000,000 records. Elapsed time: 01:25:18s. Time for last 1,000,000: 7s. Last read position: NC_000001.11:245,687,687
INFO 2021-09-21 14:35:54 AbstractAlignmentMerger Merged 189,000,000 records. Elapsed time: 01:25:27s. Time for last 1,000,000: 9s. Last read position: NC_000018.10:2,924,372
INFO 2021-09-21 14:36:03 AbstractAlignmentMerger Merged 190,000,000 records. Elapsed time: 01:25:35s. Time for last 1,000,000: 8s. Last read position: NC_000019.10:55,442,368
INFO 2021-09-21 14:36:12 AbstractAlignmentMerger Merged 191,000,000 records. Elapsed time: 01:25:45s. Time for last 1,000,000: 9s. Last read position: NC_000005.10:119,143,802
INFO 2021-09-21 14:36:21 AbstractAlignmentMerger Merged 192,000,000 records. Elapsed time: 01:25:53s. Time for last 1,000,000: 8s. Last read position: NC_000002.12:48,621,202
INFO 2021-09-21 14:36:28 AbstractAlignmentMerger Merged 193,000,000 records. Elapsed time: 01:26:01s. Time for last 1,000,000: 7s. Last read position: NC_000006.12:86,527,002
INFO 2021-09-21 14:36:37 AbstractAlignmentMerger Merged 194,000,000 records. Elapsed time: 01:26:09s. Time for last 1,000,000: 8s. Last read position: NC_000005.10:146,900,817
INFO 2021-09-21 14:36:45 AbstractAlignmentMerger Merged 195,000,000 records. Elapsed time: 01:26:17s. Time for last 1,000,000: 8s. Last read position: NC_000010.11:50,658,269
INFO 2021-09-21 14:36:53 AbstractAlignmentMerger Merged 196,000,000 records. Elapsed time: 01:26:25s. Time for last 1,000,000: 7s. Last read position: NC_000019.10:57,575,668
INFO 2021-09-21 14:37:00 AbstractAlignmentMerger Merged 197,000,000 records. Elapsed time: 01:26:33s. Time for last 1,000,000: 7s. Last read position: NC_000009.12:116,863,570
INFO 2021-09-21 14:38:30 AbstractAlignmentMerger Written in coordinate order to output 10,000,000 records. Elapsed time: 00:01:26s. Time for last 10,000,000: 84s. Last read position: NC_000001.11:145,305,942
INFO 2021-09-21 14:39:54 AbstractAlignmentMerger Written in coordinate order to output 20,000,000 records. Elapsed time: 00:02:50s. Time for last 10,000,000: 83s. Last read position: NC_000002.12:23,693,322
INFO 2021-09-21 14:41:19 AbstractAlignmentMerger Written in coordinate order to output 30,000,000 records. Elapsed time: 00:04:14s. Time for last 10,000,000: 84s. Last read position: NC_000002.12:201,129,848
INFO 2021-09-21 14:42:45 AbstractAlignmentMerger Written in coordinate order to output 40,000,000 records. Elapsed time: 00:05:40s. Time for last 10,000,000: 86s. Last read position: NC_000003.12:128,486,918
INFO 2021-09-21 14:44:09 AbstractAlignmentMerger Written in coordinate order to output 50,000,000 records. Elapsed time: 00:07:04s. Time for last 10,000,000: 84s. Last read position: NC_000004.12:153,635,467
INFO 2021-09-21 14:45:39 AbstractAlignmentMerger Written in coordinate order to output 60,000,000 records. Elapsed time: 00:08:34s. Time for last 10,000,000: 90s. Last read position: NC_000006.12:2,766,255
INFO 2021-09-21 14:47:03 AbstractAlignmentMerger Written in coordinate order to output 70,000,000 records. Elapsed time: 00:09:59s. Time for last 10,000,000: 84s. Last read position: NC_000007.14:34,520,362
INFO 2021-09-21 14:48:30 AbstractAlignmentMerger Written in coordinate order to output 80,000,000 records. Elapsed time: 00:11:26s. Time for last 10,000,000: 86s. Last read position: NC_000008.11:55,452,141
INFO 2021-09-21 14:50:04 AbstractAlignmentMerger Written in coordinate order to output 90,000,000 records. Elapsed time: 00:13:00s. Time for last 10,000,000: 94s. Last read position: NC_000009.12:128,151,453
INFO 2021-09-21 14:51:37 AbstractAlignmentMerger Written in coordinate order to output 100,000,000 records. Elapsed time: 00:14:32s. Time for last 10,000,000: 92s. Last read position: NC_000011.10:1,223,303
INFO 2021-09-21 14:53:00 AbstractAlignmentMerger Written in coordinate order to output 110,000,000 records. Elapsed time: 00:15:56s. Time for last 10,000,000: 83s. Last read position: NC_000012.12:440,714
INFO 2021-09-21 14:54:22 AbstractAlignmentMerger Written in coordinate order to output 120,000,000 records. Elapsed time: 00:17:17s. Time for last 10,000,000: 81s. Last read position: NC_000013.11:28,467,484
INFO 2021-09-21 14:55:42 AbstractAlignmentMerger Written in coordinate order to output 130,000,000 records. Elapsed time: 00:18:38s. Time for last 10,000,000: 80s. Last read position: NC_000015.10:40,461,955
INFO 2021-09-21 14:57:01 AbstractAlignmentMerger Written in coordinate order to output 140,000,000 records. Elapsed time: 00:19:57s. Time for last 10,000,000: 79s. Last read position: NC_000016.10:49,281,458
INFO 2021-09-21 14:58:22 AbstractAlignmentMerger Written in coordinate order to output 150,000,000 records. Elapsed time: 00:21:17s. Time for last 10,000,000: 80s. Last read position: NC_000017.11:50,356,198
INFO 2021-09-21 14:59:44 AbstractAlignmentMerger Written in coordinate order to output 160,000,000 records. Elapsed time: 00:22:39s. Time for last 10,000,000: 82s. Last read position: NC_000019.10:12,948,128
INFO 2021-09-21 15:01:04 AbstractAlignmentMerger Written in coordinate order to output 170,000,000 records. Elapsed time: 00:24:00s. Time for last 10,000,000: 80s. Last read position: NC_000020.11:35,696,417
INFO 2021-09-21 15:02:28 AbstractAlignmentMerger Written in coordinate order to output 180,000,000 records. Elapsed time: 00:25:23s. Time for last 10,000,000: 83s. Last read position: NC_000023.11:24,313,046
INFO 2021-09-21 15:03:55 AbstractAlignmentMerger Written in coordinate order to output 190,000,000 records. Elapsed time: 00:26:50s. Time for last 10,000,000: 86s. Last read position: NW_011332699.1:252,710
INFO 2021-09-21 15:05:02 AbstractAlignmentMerger Wrote 196821529 alignment records and 608070 unmapped reads.
[Tue Sep 21 15:05:02 CEST 2021] picard.sam.MergeBamAlignment done. Elapsed time: 115.17 minutes.
Runtime.totalMemory()=938999808 -
Hi Priyadarshini Thirunavukkarasu,
You may be able to get to the bottom of this issue if you check out what these error messages mean from this ValidateSamFile document: https://gatk.broadinstitute.org/hc/en-us/articles/360035891231-Errors-in-SAM-or-BAM-files-can-be-diagnosed-with-ValidateSamFile. It looks like what you posted above was a summary, you can run ValidateSamFile in VERBOSE mode to get more information about which reads have these issues. You can then inspect those individual reads to find out what went wrong.
We would expect FixMateInformation to be able to solve this problem you are having, so it is strange that it did not fix the issue. Could you post here all the commands you ran with this data from the beginning of your analysis?
Best,
Genevieve
-
java -jar $EBROOTPICARD/picard.jar FastqToSam FASTQ=/scicore/home/cichon/GROUP/DATA/Diabetes_family_exome/sample_1.fq.gz FASTQ2=/scicore/home/cichon/GROUP/DATA/Diabetes_family_exome/sample_2.fq.gz OUTPUT=ROUP/DATA/Diabetes_family_exome/output/sampleu.bam READ_GROUP_NAME=A00684.1 SAMPLE_NAME=1 LIBRARY_NAME=P2021-133-EXO PLATFORM_UNIT=A00684:110:H2TYCDMXY:1 PLATFORM=illumina
java -jar $EBROOTPICARD/picard.jar SortSam \
I=output/sampleu.bam \
O= output/sorted_unmapped/sample_usort.bam \
SORT_ORDER=queryname
java -jar $EBROOTPICARD/picard.jar MarkIlluminaAdapters \ ##didn't have the adapter information, the command seem to mark adapters
I=output/sorted_unmapped/sample_usort.bam \
O=output/adapter_marked/sample_ad.bam \
M=output/adapter_marked/sample_ad.txt
java -jar picard.jar SamToFastq
I=output/sorted_unmapped/sample_usort.bam
FASTQ=/DATA/Diabetes_family_exome/unmap_fastq/sample_pair1.fq
SECOND_END_FASTQ=/DATA/Diabetes_family_exome/unmap_fastq/sample_pair2.fq
bwa-mem2 mem -t8 -M DATA/ref/gch38.fa DATA/Diabetes_family_exome/unmap_fastq/sample_pair1.fq /DATA/Diabetes_family_exome/unmap_fastq/sample_pair2.fq > data/output/aligned/1_al.sam
java -jar $EBROOTPICARD/picard.jar SortSam \
I=data/output/aligned/sample_al.sam \
O=data/output/aligned/sample-al.bam \
SORT_ORDER=queryname
java -jar $EBROOTPICARD/picard.jar AddOrReplaceReadGroups I=/output/aligned/sample-al.bam O=sample_al_RG.bam RGID=A00684.1 RGSM=1 RGLB=P2021-133-EXO RGPU=A00684:110:H2TYCDMXY:1 RGPL=illumina
java -jar $EBROOTPICARD/picard.jar MergeBamAlignment \
ALIGNED=data/output/aligned/sample-al.bam \
UNMAPPED=output/adapter_marked/sample_ad.bam \
O=output/merged/sample_merge.bam \
R=DATA/ref/gch38.fa \
SORT_ORDER=coordinate \
CREATE_INDEX=true
##Validated merged bam file using ValidateSamFile command
picard.sam.ValidateSamFile INPUT=1_merge_rg.bam MODE=VERBOSE MAX_OUTPUT=100 IGNORE_WARNINGS=false VALIDATE_INDEX=true INDEX_VALIDATION_STRINGENCY=EXHAUSTIVE IS_BISULFITE_SEQUENCED=false MAX_OPEN_TEMP_FILES=8000 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json
[Tue Sep 28 16:45:12 CEST 2021] Executing as thirun0000@login20.cluster.bc2.ch on Linux 3.10.0-1160.41.1.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 1.8.0_212-b03; Picard version: 2.6.0-SNAPSHOT
ERROR: Record 121717, Read name A00684:110:H2TYCDMXY:1:2249:2636:20149, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 121716, Read name A00684:110:H2TYCDMXY:1:2249:2636:20149, Both mates are marked as first of pair
ERROR: Record 121718, Read name A00684:110:H2TYCDMXY:1:2249:2636:20149, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 121718, Read name A00684:110:H2TYCDMXY:1:2249:2636:20149, Both mates are marked as second of pair
ERROR: Record 208514, Read name A00684:110:H2TYCDMXY:2:1139:4020:16407, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 208513, Read name A00684:110:H2TYCDMXY:2:1139:4020:16407, Both mates are marked as first of pair
ERROR: Record 208515, Read name A00684:110:H2TYCDMXY:2:1139:4020:16407, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 208515, Read name A00684:110:H2TYCDMXY:2:1139:4020:16407, Both mates are marked as second of pair
ERROR: Record 315547, Read name A00684:110:H2TYCDMXY:2:1126:31024:3364, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 315546, Read name A00684:110:H2TYCDMXY:2:1126:31024:3364, Both mates are marked as first of pair
ERROR: Record 315548, Read name A00684:110:H2TYCDMXY:2:1126:31024:3364, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 315548, Read name A00684:110:H2TYCDMXY:2:1126:31024:3364, Both mates are marked as second of pair
ERROR: Record 410604, Read name A00684:110:H2TYCDMXY:1:1247:4499:15233, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 410603, Read name A00684:110:H2TYCDMXY:1:1247:4499:15233, Both mates are marked as first of pair
ERROR: Record 410605, Read name A00684:110:H2TYCDMXY:1:1247:4499:15233, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 410605, Read name A00684:110:H2TYCDMXY:1:1247:4499:15233, Both mates are marked as second of pair
ERROR: Record 459727, Read name A00684:110:H2TYCDMXY:1:1357:6153:25269, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 459727, Read name A00684:110:H2TYCDMXY:1:1357:6153:25269, Mate CIGAR string does not match CIGAR string of mate
ERROR: Record 459726, Read name A00684:110:H2TYCDMXY:1:1357:6153:25269, Both mates are marked as first of pair
ERROR: Record 459728, Read name A00684:110:H2TYCDMXY:1:1357:6153:25269, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 459728, Read name A00684:110:H2TYCDMXY:1:1357:6153:25269, Mate CIGAR string does not match CIGAR string of mate
ERROR: Record 459728, Read name A00684:110:H2TYCDMXY:1:1357:6153:25269, Both mates are marked as second of pair
ERROR: Record 489153, Read name A00684:110:H2TYCDMXY:2:2138:3314:9768, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 489153, Read name A00684:110:H2TYCDMXY:2:2138:3314:9768, Mate CIGAR string does not match CIGAR string of mate
ERROR: Record 489152, Read name A00684:110:H2TYCDMXY:2:2138:3314:9768, Both mates are marked as first of pair
ERROR: Record 489154, Read name A00684:110:H2TYCDMXY:2:2138:3314:9768, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 489154, Read name A00684:110:H2TYCDMXY:2:2138:3314:9768, Mate CIGAR string does not match CIGAR string of mate
ERROR: Record 489154, Read name A00684:110:H2TYCDMXY:2:2138:3314:9768, Both mates are marked as second of pair
ERROR: Record 630220, Read name A00684:110:H2TYCDMXY:2:2229:8413:33442, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 630220, Read name A00684:110:H2TYCDMXY:2:2229:8413:33442, Mate CIGAR string does not match CIGAR string of mate
ERROR: Record 630219, Read name A00684:110:H2TYCDMXY:2:2229:8413:33442, Both mates are marked as first of pair
ERROR: Record 630221, Read name A00684:110:H2TYCDMXY:2:2229:8413:33442, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 630221, Read name A00684:110:H2TYCDMXY:2:2229:8413:33442, Mate CIGAR string does not match CIGAR string of mate
ERROR: Record 630221, Read name A00684:110:H2TYCDMXY:2:2229:8413:33442, Both mates are marked as second of pair
ERROR: Record 655122, Read name A00684:110:H2TYCDMXY:1:1482:5032:5760, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 655121, Read name A00684:110:H2TYCDMXY:1:1482:5032:5760, Both mates are marked as first of pair
ERROR: Record 655123, Read name A00684:110:H2TYCDMXY:1:1482:5032:5760, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 655123, Read name A00684:110:H2TYCDMXY:1:1482:5032:5760, Both mates are marked as second of pair
ERROR: Record 685425, Read name A00684:110:H2TYCDMXY:2:1472:22480:25426, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 685424, Read name A00684:110:H2TYCDMXY:2:1472:22480:25426, Both mates are marked as first of pair
ERROR: Record 685426, Read name A00684:110:H2TYCDMXY:2:1472:22480:25426, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 685426, Read name A00684:110:H2TYCDMXY:2:1472:22480:25426, Both mates are marked as second of pair
ERROR: Record 730901, Read name A00684:110:H2TYCDMXY:2:1257:11252:12962, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 730900, Read name A00684:110:H2TYCDMXY:2:1257:11252:12962, Both mates are marked as first of pair
ERROR: Record 730904, Read name A00684:110:H2TYCDMXY:2:1257:13738:11443, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 730903, Read name A00684:110:H2TYCDMXY:2:1257:13738:11443, Both mates are marked as first of pair
ERROR: Record 730907, Read name A00684:110:H2TYCDMXY:2:2257:8811:5196, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 730906, Read name A00684:110:H2TYCDMXY:2:2257:8811:5196, Both mates are marked as first of pair
ERROR: Record 730910, Read name A00684:110:H2TYCDMXY:2:2345:27624:6214, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 730909, Read name A00684:110:H2TYCDMXY:2:2345:27624:6214, Both mates are marked as first of pair
ERROR: Record 730902, Read name A00684:110:H2TYCDMXY:2:1257:11252:12962, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 730902, Read name A00684:110:H2TYCDMXY:2:1257:11252:12962, Both mates are marked as second of pair
ERROR: Record 730905, Read name A00684:110:H2TYCDMXY:2:1257:13738:11443, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 730905, Read name A00684:110:H2TYCDMXY:2:1257:13738:11443, Both mates are marked as second of pair
ERROR: Record 730908, Read name A00684:110:H2TYCDMXY:2:2257:8811:5196, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 730908, Read name A00684:110:H2TYCDMXY:2:2257:8811:5196, Both mates are marked as second of pair
ERROR: Record 730911, Read name A00684:110:H2TYCDMXY:2:2345:27624:6214, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 730911, Read name A00684:110:H2TYCDMXY:2:2345:27624:6214, Both mates are marked as second of pair
ERROR: Record 734507, Read name A00684:110:H2TYCDMXY:1:2208:8847:15186, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 734506, Read name A00684:110:H2TYCDMXY:1:2208:8847:15186, Both mates are marked as first of pair
ERROR: Record 734508, Read name A00684:110:H2TYCDMXY:1:2208:8847:15186, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 734508, Read name A00684:110:H2TYCDMXY:1:2208:8847:15186, Both mates are marked as second of pair
ERROR: Record 800804, Read name A00684:110:H2TYCDMXY:2:2378:11957:10927, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 800804, Read name A00684:110:H2TYCDMXY:2:2378:11957:10927, Mate CIGAR string does not match CIGAR string of mate
ERROR: Record 800803, Read name A00684:110:H2TYCDMXY:2:2378:11957:10927, Both mates are marked as first of pair
ERROR: Record 800805, Read name A00684:110:H2TYCDMXY:2:2378:11957:10927, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 800805, Read name A00684:110:H2TYCDMXY:2:2378:11957:10927, Mate CIGAR string does not match CIGAR string of mate
ERROR: Record 800805, Read name A00684:110:H2TYCDMXY:2:2378:11957:10927, Both mates are marked as second of pair
ERROR: Record 855916, Read name A00684:110:H2TYCDMXY:2:2383:19651:24627, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 855915, Read name A00684:110:H2TYCDMXY:2:2383:19651:24627, Both mates are marked as first of pair
ERROR: Record 855917, Read name A00684:110:H2TYCDMXY:2:2383:19651:24627, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 855917, Read name A00684:110:H2TYCDMXY:2:2383:19651:24627, Both mates are marked as second of pair
ERROR: Record 862324, Read name A00684:110:H2TYCDMXY:1:2427:26404:3286, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 862324, Read name A00684:110:H2TYCDMXY:1:2427:26404:3286, Mate CIGAR string does not match CIGAR string of mate
ERROR: Record 862323, Read name A00684:110:H2TYCDMXY:1:2427:26404:3286, Both mates are marked as first of pair
ERROR: Record 862325, Read name A00684:110:H2TYCDMXY:1:2427:26404:3286, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 862325, Read name A00684:110:H2TYCDMXY:1:2427:26404:3286, Mate CIGAR string does not match CIGAR string of mate
ERROR: Record 862325, Read name A00684:110:H2TYCDMXY:1:2427:26404:3286, Both mates are marked as second of pair
ERROR: Record 886872, Read name A00684:110:H2TYCDMXY:2:2228:19840:12242, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 886871, Read name A00684:110:H2TYCDMXY:2:2228:19840:12242, Both mates are marked as first of pair
ERROR: Record 886873, Read name A00684:110:H2TYCDMXY:2:2228:19840:12242, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 886873, Read name A00684:110:H2TYCDMXY:2:2228:19840:12242, Both mates are marked as second of pair
ERROR: Record 1021514, Read name A00684:110:H2TYCDMXY:2:1260:30662:23469, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 1021513, Read name A00684:110:H2TYCDMXY:2:1260:30662:23469, Both mates are marked as first of pair
ERROR: Record 1021515, Read name A00684:110:H2TYCDMXY:2:1260:30662:23469, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 1021515, Read name A00684:110:H2TYCDMXY:2:1260:30662:23469, Both mates are marked as second of pair
ERROR: Record 1032232, Read name A00684:110:H2TYCDMXY:2:1247:30219:34413, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 1032232, Read name A00684:110:H2TYCDMXY:2:1247:30219:34413, Mate CIGAR string does not match CIGAR string of mate
ERROR: Record 1032231, Read name A00684:110:H2TYCDMXY:2:1247:30219:34413, Both mates are marked as first of pair
ERROR: Record 1032233, Read name A00684:110:H2TYCDMXY:2:1247:30219:34413, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 1032233, Read name A00684:110:H2TYCDMXY:2:1247:30219:34413, Mate CIGAR string does not match CIGAR string of mate
ERROR: Record 1032233, Read name A00684:110:H2TYCDMXY:2:1247:30219:34413, Both mates are marked as second of pair
ERROR: Record 1046389, Read name A00684:110:H2TYCDMXY:1:1310:4164:17472, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 1046389, Read name A00684:110:H2TYCDMXY:1:1310:4164:17472, Mate CIGAR string does not match CIGAR string of mate
ERROR: Record 1046388, Read name A00684:110:H2TYCDMXY:1:1310:4164:17472, Both mates are marked as first of pair
ERROR: Record 1046390, Read name A00684:110:H2TYCDMXY:1:1310:4164:17472, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 1046390, Read name A00684:110:H2TYCDMXY:1:1310:4164:17472, Mate CIGAR string does not match CIGAR string of mate
ERROR: Record 1046390, Read name A00684:110:H2TYCDMXY:1:1310:4164:17472, Both mates are marked as second of pair
ERROR: Record 1096435, Read name A00684:110:H2TYCDMXY:1:1481:28067:17597, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 1096434, Read name A00684:110:H2TYCDMXY:1:1481:28067:17597, Both mates are marked as first of pair -
Hi Priyadarshini Thirunavukkarasu,
You can add read groups in your BWA command with the -R option and then you wouldn't need to run the AddorReplaceReadGroups step.
Could you share the output from ValidateSamFile before MergeBamAlignment?
Best,
Genevieve
-
### Validated unmapped and adapter marked bam file
picard.sam.ValidateSamFile INPUT=1_ucleancheck.sorted_adap-mark.bam MODE=VERBOSE MAX_OUTPUT=100 IGNORE_WARNINGS=false VALIDATE_INDEX=true INDEX_VALIDATION_STRINGENCY=EXHAUSTIVE IS_BISULFITE_SEQUENCED=false MAX_OPEN_TEMP_FILES=8000 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json
[Wed Sep 29 08:48:55 CEST 2021] Executing as thirun0000@login20.cluster.bc2.ch on Linux 3.10.0-1160.41.1.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 1.8.0_212-b03; Picard version: 2.6.0-SNAPSHOT
INFO 2021-09-29 08:49:30 SamFileValidator Validated Read 10,000,000 records. Elapsed time: 00:00:34s. Time for last 10,000,000: 34s. Last read position: */*
INFO 2021-09-29 08:50:03 SamFileValidator Validated Read 20,000,000 records. Elapsed time: 00:01:08s. Time for last 10,000,000: 33s. Last read position: */*
INFO 2021-09-29 08:50:36 SamFileValidator Validated Read 30,000,000 records. Elapsed time: 00:01:41s. Time for last 10,000,000: 32s. Last read position: */*
INFO 2021-09-29 08:51:09 SamFileValidator Validated Read 40,000,000 records. Elapsed time: 00:02:14s. Time for last 10,000,000: 33s. Last read position: */*
INFO 2021-09-29 08:51:43 SamFileValidator Validated Read 50,000,000 records. Elapsed time: 00:02:48s. Time for last 10,000,000: 34s. Last read position: */*
INFO 2021-09-29 08:52:15 SamFileValidator Validated Read 60,000,000 records. Elapsed time: 00:03:20s. Time for last 10,000,000: 31s. Last read position: */*
INFO 2021-09-29 08:52:47 SamFileValidator Validated Read 70,000,000 records. Elapsed time: 00:03:52s. Time for last 10,000,000: 31s. Last read position: */*
INFO 2021-09-29 08:53:19 SamFileValidator Validated Read 80,000,000 records. Elapsed time: 00:04:24s. Time for last 10,000,000: 32s. Last read position: */*
INFO 2021-09-29 08:53:51 SamFileValidator Validated Read 90,000,000 records. Elapsed time: 00:04:56s. Time for last 10,000,000: 31s. Last read position: */*
INFO 2021-09-29 08:54:23 SamFileValidator Validated Read 100,000,000 records. Elapsed time: 00:05:28s. Time for last 10,000,000: 32s. Last read position: */*
INFO 2021-09-29 08:54:55 SamFileValidator Validated Read 110,000,000 records. Elapsed time: 00:06:00s. Time for last 10,000,000: 31s. Last read position: */*
INFO 2021-09-29 08:55:27 SamFileValidator Validated Read 120,000,000 records. Elapsed time: 00:06:32s. Time for last 10,000,000: 31s. Last read position: */*
INFO 2021-09-29 08:55:59 SamFileValidator Validated Read 130,000,000 records. Elapsed time: 00:07:03s. Time for last 10,000,000: 31s. Last read position: */*
INFO 2021-09-29 08:56:31 SamFileValidator Validated Read 140,000,000 records. Elapsed time: 00:07:35s. Time for last 10,000,000: 32s. Last read position: */*
INFO 2021-09-29 08:57:02 SamFileValidator Validated Read 150,000,000 records. Elapsed time: 00:08:07s. Time for last 10,000,000: 31s. Last read position: */*
INFO 2021-09-29 08:57:34 SamFileValidator Validated Read 160,000,000 records. Elapsed time: 00:08:39s. Time for last 10,000,000: 31s. Last read position: */*
INFO 2021-09-29 08:58:06 SamFileValidator Validated Read 170,000,000 records. Elapsed time: 00:09:11s. Time for last 10,000,000: 31s. Last read position: */*
INFO 2021-09-29 08:58:38 SamFileValidator Validated Read 180,000,000 records. Elapsed time: 00:09:43s. Time for last 10,000,000: 31s. Last read position: */*
INFO 2021-09-29 08:59:10 SamFileValidator Validated Read 190,000,000 records. Elapsed time: 00:10:15s. Time for last 10,000,000: 31s. Last read position: */*
No errors found
[Wed Sep 29 08:59:32 CEST 2021] picard.sam.ValidateSamFile done. Elapsed time: 10.63 minutes.
Runtime.totalMemory()=162201600
#### Validated aligned bam file
To execute picard run: java -jar $EBROOTPICARD/picard.jar
[Thu Sep 23 12:42:58 CEST 2021] picard.sam.ValidateSamFile INPUT=1_aligned_RG.bam MODE=SUMMARY MAX_OUTPUT=100 IGNORE_WARNINGS=false VALIDATE_INDEX=true INDEX_VALIDATION_STRINGENCY=EXHAUSTIVE IS_BISULFITE_SEQUENCED=false MAX_OPEN_TEMP_FILES=8000 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json
[Thu Sep 23 12:42:58 CEST 2021] Executing as gonzalea@shi87.cluster.bc2.ch on Linux 3.10.0-1062.18.1.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 1.8.0_212-b03; Picard version: 2.6.0-SNAPSHOT
INFO 2021-09-23 12:43:49 SamFileValidator Validated Read 10,000,000 records. Elapsed time: 00:00:51s. Time for last 10,000,000: 51s. Last read position: NC_000022.11:30,611,007
INFO 2021-09-23 12:44:34 SamFileValidator Validated Read 20,000,000 records. Elapsed time: 00:01:36s. Time for last 10,000,000: 45s. Last read position: NC_000011.10:128,998,486
INFO 2021-09-23 12:45:20 SamFileValidator Validated Read 30,000,000 records. Elapsed time: 00:02:21s. Time for last 10,000,000: 45s. Last read position: NC_000019.10:44,900,743
INFO 2021-09-23 12:46:05 SamFileValidator Validated Read 40,000,000 records. Elapsed time: 00:03:06s. Time for last 10,000,000: 45s. Last read position: NC_000010.11:112,432,380
INFO 2021-09-23 12:46:49 SamFileValidator Validated Read 50,000,000 records. Elapsed time: 00:03:51s. Time for last 10,000,000: 44s. Last read position: NC_000023.11:68,600,197
INFO 2021-09-23 12:47:34 SamFileValidator Validated Read 60,000,000 records. Elapsed time: 00:04:36s. Time for last 10,000,000: 44s. Last read position: NC_000016.10:14,245,258
INFO 2021-09-23 12:48:19 SamFileValidator Validated Read 70,000,000 records. Elapsed time: 00:05:21s. Time for last 10,000,000: 44s. Last read position: NC_000003.12:180,616,820
INFO 2021-09-23 12:49:04 SamFileValidator Validated Read 80,000,000 records. Elapsed time: 00:06:06s. Time for last 10,000,000: 45s. Last read position: NC_000017.11:63,827,427
INFO 2021-09-23 12:49:49 SamFileValidator Validated Read 90,000,000 records. Elapsed time: 00:06:51s. Time for last 10,000,000: 45s. Last read position: NC_000014.9:34,605,629
INFO 2021-09-23 12:50:35 SamFileValidator Validated Read 100,000,000 records. Elapsed time: 00:07:37s. Time for last 10,000,000: 45s. Last read position: NC_000019.10:15,652,639
INFO 2021-09-23 12:51:20 SamFileValidator Validated Read 110,000,000 records. Elapsed time: 00:08:22s. Time for last 10,000,000: 45s. Last read position: NT_187635.1:72,982
INFO 2021-09-23 12:52:05 SamFileValidator Validated Read 120,000,000 records. Elapsed time: 00:09:07s. Time for last 10,000,000: 45s. Last read position: NC_000011.10:67,237,674
INFO 2021-09-23 12:52:51 SamFileValidator Validated Read 130,000,000 records. Elapsed time: 00:09:52s. Time for last 10,000,000: 45s. Last read position: NT_187600.1:1,070,585
INFO 2021-09-23 12:53:36 SamFileValidator Validated Read 140,000,000 records. Elapsed time: 00:10:38s. Time for last 10,000,000: 45s. Last read position: NC_000022.11:39,511,807
INFO 2021-09-23 12:54:21 SamFileValidator Validated Read 150,000,000 records. Elapsed time: 00:11:22s. Time for last 10,000,000: 44s. Last read position: NC_000001.11:145,320,468
INFO 2021-09-23 12:55:05 SamFileValidator Validated Read 160,000,000 records. Elapsed time: 00:12:07s. Time for last 10,000,000: 44s. Last read position: NC_000018.10:2,909,678
INFO 2021-09-23 12:55:51 SamFileValidator Validated Read 170,000,000 records. Elapsed time: 00:12:53s. Time for last 10,000,000: 45s. Last read position: NC_000012.12:72,031,431
INFO 2021-09-23 12:56:36 SamFileValidator Validated Read 180,000,000 records. Elapsed time: 00:13:37s. Time for last 10,000,000: 44s. Last read position: NT_187556.1:318,830
INFO 2021-09-23 12:57:21 SamFileValidator Validated Read 190,000,000 records. Elapsed time: 00:14:22s. Time for last 10,000,000: 45s. Last read position: NC_000016.10:87,689,671
No errors found -
Okay I see, thank you so much!
I'm still having trouble nailing down why you would be getting this error message, its quite strange that it came up after MergeBamAlignment. I noticed that you are running an old version of Picard (2.6) which came out in 2016. We are currently on 2.26.2 and there could have been bug fixes since 2016 that would fix this issue. Could you try updating your Picard version and running this pipeline to verify if the issue persists?
-
Okay Thanks, I will try that and get back to you
-
I updated to recent picard version (2.26.2) and merged the bam files. The merged bam file was validated using ValidateSamFile command and the errors still shows up in the file
java -jar $EBROOTPICARD/picard.jar ValidateSamFile \
> I=1_merge_rg.bam \
> MODE=VERBOSE
INFO 2021-09-30 15:58:28 ValidateSamFile
********** NOTE: Picard's command line syntax is changing.
**********
********** For more information, please see:
********** https://github.com/broadinstitute/picard/wiki/Command-Line-Syntax-Transition-For-Users-(Pre-Transition)
**********
********** The command line looks like this in the new syntax:
**********
********** ValidateSamFile -I 1_merge_rg.bam -MODE VERBOSE
**********
15:58:29.312 INFO NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/scicore/soft/apps/picard/2.26.2-Java-1.8/picard.jar!/com/intel/gkl/native/libgkl_compression.so
[Thu Sep 30 15:58:29 CEST 2021] ValidateSamFile INPUT=1_merge_rg.bam MODE=VERBOSE MAX_OUTPUT=100 IGNORE_WARNINGS=false VALIDATE_INDEX=true INDEX_VALIDATION_STRINGENCY=EXHAUSTIVE IS_BISULFITE_SEQUENCED=false MAX_OPEN_TEMP_FILES=8000 SKIP_MATE_VALIDATION=false VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USE_JDK_INFLATER=false
[Thu Sep 30 15:58:29 CEST 2021] Executing as thirun0000@login20.cluster.bc2.ch on Linux 3.10.0-1160.41.1.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 1.8.0_212-b03; Deflater: Intel; Inflater: Intel; Provider GCS is not available; Picard version: 2.26.2
WARNING 2021-09-30 15:58:29 ValidateSamFile NM validation cannot be performed without the reference. All other validations will still occur.
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 121717, Read name A00684:110:H2TYCDMXY:1:2249:2636:20149, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 121716, Read name A00684:110:H2TYCDMXY:1:2249:2636:20149, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 121718, Read name A00684:110:H2TYCDMXY:1:2249:2636:20149, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 121718, Read name A00684:110:H2TYCDMXY:1:2249:2636:20149, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 208514, Read name A00684:110:H2TYCDMXY:2:1139:4020:16407, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 208513, Read name A00684:110:H2TYCDMXY:2:1139:4020:16407, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 208515, Read name A00684:110:H2TYCDMXY:2:1139:4020:16407, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 208515, Read name A00684:110:H2TYCDMXY:2:1139:4020:16407, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 315547, Read name A00684:110:H2TYCDMXY:2:1126:31024:3364, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 315546, Read name A00684:110:H2TYCDMXY:2:1126:31024:3364, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 315548, Read name A00684:110:H2TYCDMXY:2:1126:31024:3364, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 315548, Read name A00684:110:H2TYCDMXY:2:1126:31024:3364, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 410604, Read name A00684:110:H2TYCDMXY:1:1247:4499:15233, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 410603, Read name A00684:110:H2TYCDMXY:1:1247:4499:15233, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 410605, Read name A00684:110:H2TYCDMXY:1:1247:4499:15233, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 410605, Read name A00684:110:H2TYCDMXY:1:1247:4499:15233, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 459727, Read name A00684:110:H2TYCDMXY:1:1357:6153:25269, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MISMATCH_MATE_CIGAR_STRING:Record 459727, Read name A00684:110:H2TYCDMXY:1:1357:6153:25269, Mate CIGAR string does not match CIGAR string of mate
ERROR::MATES_ARE_SAME_END:Record 459726, Read name A00684:110:H2TYCDMXY:1:1357:6153:25269, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 459728, Read name A00684:110:H2TYCDMXY:1:1357:6153:25269, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MISMATCH_MATE_CIGAR_STRING:Record 459728, Read name A00684:110:H2TYCDMXY:1:1357:6153:25269, Mate CIGAR string does not match CIGAR string of mate
ERROR::MATES_ARE_SAME_END:Record 459728, Read name A00684:110:H2TYCDMXY:1:1357:6153:25269, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 489153, Read name A00684:110:H2TYCDMXY:2:2138:3314:9768, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MISMATCH_MATE_CIGAR_STRING:Record 489153, Read name A00684:110:H2TYCDMXY:2:2138:3314:9768, Mate CIGAR string does not match CIGAR string of mate
ERROR::MATES_ARE_SAME_END:Record 489152, Read name A00684:110:H2TYCDMXY:2:2138:3314:9768, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 489154, Read name A00684:110:H2TYCDMXY:2:2138:3314:9768, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MISMATCH_MATE_CIGAR_STRING:Record 489154, Read name A00684:110:H2TYCDMXY:2:2138:3314:9768, Mate CIGAR string does not match CIGAR string of mate
ERROR::MATES_ARE_SAME_END:Record 489154, Read name A00684:110:H2TYCDMXY:2:2138:3314:9768, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 630220, Read name A00684:110:H2TYCDMXY:2:2229:8413:33442, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MISMATCH_MATE_CIGAR_STRING:Record 630220, Read name A00684:110:H2TYCDMXY:2:2229:8413:33442, Mate CIGAR string does not match CIGAR string of mate
ERROR::MATES_ARE_SAME_END:Record 630219, Read name A00684:110:H2TYCDMXY:2:2229:8413:33442, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 630221, Read name A00684:110:H2TYCDMXY:2:2229:8413:33442, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MISMATCH_MATE_CIGAR_STRING:Record 630221, Read name A00684:110:H2TYCDMXY:2:2229:8413:33442, Mate CIGAR string does not match CIGAR string of mate
ERROR::MATES_ARE_SAME_END:Record 630221, Read name A00684:110:H2TYCDMXY:2:2229:8413:33442, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 655122, Read name A00684:110:H2TYCDMXY:1:1482:5032:5760, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 655121, Read name A00684:110:H2TYCDMXY:1:1482:5032:5760, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 655123, Read name A00684:110:H2TYCDMXY:1:1482:5032:5760, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 655123, Read name A00684:110:H2TYCDMXY:1:1482:5032:5760, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 685425, Read name A00684:110:H2TYCDMXY:2:1472:22480:25426, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 685424, Read name A00684:110:H2TYCDMXY:2:1472:22480:25426, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 685426, Read name A00684:110:H2TYCDMXY:2:1472:22480:25426, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 685426, Read name A00684:110:H2TYCDMXY:2:1472:22480:25426, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 730901, Read name A00684:110:H2TYCDMXY:2:1257:11252:12962, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 730900, Read name A00684:110:H2TYCDMXY:2:1257:11252:12962, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 730904, Read name A00684:110:H2TYCDMXY:2:1257:13738:11443, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 730903, Read name A00684:110:H2TYCDMXY:2:1257:13738:11443, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 730907, Read name A00684:110:H2TYCDMXY:2:2257:8811:5196, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 730906, Read name A00684:110:H2TYCDMXY:2:2257:8811:5196, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 730910, Read name A00684:110:H2TYCDMXY:2:2345:27624:6214, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 730909, Read name A00684:110:H2TYCDMXY:2:2345:27624:6214, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 730902, Read name A00684:110:H2TYCDMXY:2:1257:11252:12962, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 730902, Read name A00684:110:H2TYCDMXY:2:1257:11252:12962, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 730905, Read name A00684:110:H2TYCDMXY:2:1257:13738:11443, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 730905, Read name A00684:110:H2TYCDMXY:2:1257:13738:11443, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 730908, Read name A00684:110:H2TYCDMXY:2:2257:8811:5196, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 730908, Read name A00684:110:H2TYCDMXY:2:2257:8811:5196, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 730911, Read name A00684:110:H2TYCDMXY:2:2345:27624:6214, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 730911, Read name A00684:110:H2TYCDMXY:2:2345:27624:6214, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 734507, Read name A00684:110:H2TYCDMXY:1:2208:8847:15186, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 734506, Read name A00684:110:H2TYCDMXY:1:2208:8847:15186, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 734508, Read name A00684:110:H2TYCDMXY:1:2208:8847:15186, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 734508, Read name A00684:110:H2TYCDMXY:1:2208:8847:15186, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 800804, Read name A00684:110:H2TYCDMXY:2:2378:11957:10927, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MISMATCH_MATE_CIGAR_STRING:Record 800804, Read name A00684:110:H2TYCDMXY:2:2378:11957:10927, Mate CIGAR string does not match CIGAR string of mate
ERROR::MATES_ARE_SAME_END:Record 800803, Read name A00684:110:H2TYCDMXY:2:2378:11957:10927, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 800805, Read name A00684:110:H2TYCDMXY:2:2378:11957:10927, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MISMATCH_MATE_CIGAR_STRING:Record 800805, Read name A00684:110:H2TYCDMXY:2:2378:11957:10927, Mate CIGAR string does not match CIGAR string of mate
ERROR::MATES_ARE_SAME_END:Record 800805, Read name A00684:110:H2TYCDMXY:2:2378:11957:10927, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 855916, Read name A00684:110:H2TYCDMXY:2:2383:19651:24627, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 855915, Read name A00684:110:H2TYCDMXY:2:2383:19651:24627, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 855917, Read name A00684:110:H2TYCDMXY:2:2383:19651:24627, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 855917, Read name A00684:110:H2TYCDMXY:2:2383:19651:24627, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 862324, Read name A00684:110:H2TYCDMXY:1:2427:26404:3286, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MISMATCH_MATE_CIGAR_STRING:Record 862324, Read name A00684:110:H2TYCDMXY:1:2427:26404:3286, Mate CIGAR string does not match CIGAR string of mate
ERROR::MATES_ARE_SAME_END:Record 862323, Read name A00684:110:H2TYCDMXY:1:2427:26404:3286, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 862325, Read name A00684:110:H2TYCDMXY:1:2427:26404:3286, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MISMATCH_MATE_CIGAR_STRING:Record 862325, Read name A00684:110:H2TYCDMXY:1:2427:26404:3286, Mate CIGAR string does not match CIGAR string of mate
ERROR::MATES_ARE_SAME_END:Record 862325, Read name A00684:110:H2TYCDMXY:1:2427:26404:3286, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 886872, Read name A00684:110:H2TYCDMXY:2:2228:19840:12242, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 886871, Read name A00684:110:H2TYCDMXY:2:2228:19840:12242, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 886873, Read name A00684:110:H2TYCDMXY:2:2228:19840:12242, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 886873, Read name A00684:110:H2TYCDMXY:2:2228:19840:12242, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 1021514, Read name A00684:110:H2TYCDMXY:2:1260:30662:23469, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 1021513, Read name A00684:110:H2TYCDMXY:2:1260:30662:23469, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 1021515, Read name A00684:110:H2TYCDMXY:2:1260:30662:23469, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 1021515, Read name A00684:110:H2TYCDMXY:2:1260:30662:23469, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 1032232, Read name A00684:110:H2TYCDMXY:2:1247:30219:34413, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MISMATCH_MATE_CIGAR_STRING:Record 1032232, Read name A00684:110:H2TYCDMXY:2:1247:30219:34413, Mate CIGAR string does not match CIGAR string of mate
ERROR::MATES_ARE_SAME_END:Record 1032231, Read name A00684:110:H2TYCDMXY:2:1247:30219:34413, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 1032233, Read name A00684:110:H2TYCDMXY:2:1247:30219:34413, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MISMATCH_MATE_CIGAR_STRING:Record 1032233, Read name A00684:110:H2TYCDMXY:2:1247:30219:34413, Mate CIGAR string does not match CIGAR string of mate
ERROR::MATES_ARE_SAME_END:Record 1032233, Read name A00684:110:H2TYCDMXY:2:1247:30219:34413, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 1046389, Read name A00684:110:H2TYCDMXY:1:1310:4164:17472, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MISMATCH_MATE_CIGAR_STRING:Record 1046389, Read name A00684:110:H2TYCDMXY:1:1310:4164:17472, Mate CIGAR string does not match CIGAR string of mate
ERROR::MATES_ARE_SAME_END:Record 1046388, Read name A00684:110:H2TYCDMXY:1:1310:4164:17472, Both mates are marked as first of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 1046390, Read name A00684:110:H2TYCDMXY:1:1310:4164:17472, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MISMATCH_MATE_CIGAR_STRING:Record 1046390, Read name A00684:110:H2TYCDMXY:1:1310:4164:17472, Mate CIGAR string does not match CIGAR string of mate
ERROR::MATES_ARE_SAME_END:Record 1046390, Read name A00684:110:H2TYCDMXY:1:1310:4164:17472, Both mates are marked as second of pair
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 1096435, Read name A00684:110:H2TYCDMXY:1:1481:28067:17597, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 1096434, Read name A00684:110:H2TYCDMXY:1:1481:28067:17597, Both mates are marked as first of pair
Maximum output of [100] errors reached.
[Thu Sep 30 15:58:36 CEST 2021] picard.sam.ValidateSamFile done. Elapsed time: 0.13 minutes.
Runtime.totalMemory()=162201600
To get help, see http://broadinstitute.github.io/picard/index.html#GettingHelp -
Oh no! I was hoping that would solve this issue since it is something I haven't seen before. Unfortunately I think the next step to find out what is happening would be looking at the specific reads before and after MergeBamAlignment. For example, you can take a look at this error:
ERROR::MISMATCH_FLAG_MATE_NEG_STRAND:Record 121718, Read name A00684:110:H2TYCDMXY:1:2249:2636:20149, Mate negative strand flag does not match read negative strand flag of mate
ERROR::MATES_ARE_SAME_END:Record 121718, Read name A00684:110:H2TYCDMXY:1:2249:2636:20149, Both mates are marked as second of pairTake a look at the A00684:110:H2TYCDMXY:1:2249:2636:20149 read and find out what is changing during MergeBamAlignment to cause the mate negative strand flag to not match the mate negative strand flag in the read itself. Also, why both mates are marked as second of pair.
You can read more about reading SAM files here: https://gatk.broadinstitute.org/hc/en-us/articles/360035890791-SAM-or-BAM-or-CRAM-Mapped-sequence-data-formats
-
Thank you. In the unmapped bam file, there were two reads and in the aligned bam files there were four reads (A00684:110:H2TYCDMXY:1:2249:2636:20149)
In the merged bam file, there were 6 reads. Among the 6 reads, 2 reads were unmapped and in the other four reads, the mates were unmapped
Shown below for merged bam file:
samtools view 1_merge_rg.bam | grep 'A00684:110:H2TYCDMXY:2:1139:4020:16407' | less
A00684:110:H2TYCDMXY:1:2249:2636:20149 75 NC_000001.11 1029408 60 36S57M = 1029408 0 GTTCTGTATGATTCCTACCGTTCGATTTCATTTTGTTGGGGGGGACATCAGTGTCTATGCAGGCAGGTAGGGGGAGGGGGACATCCCGCGTCT FFFFFF,FFFFFFFFFFFFFFFFFFFFFFFF::FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF SA:Z:NT_187425.1,105480,-,56S37M,0,1; MD:Z:52T4 PG:Z:bwa-mem2 RG:Z:A00684.1 NM:i:1 UQ:i:37 AS:i:52
A00684:110:H2TYCDMXY:1:2249:2636:20149 101 NC_000001.11 1029408 0 * = 1029408 0 GTTCTGTATGATTCCTACCGTTCGATTTCATTTTGTTGGGGGGGACATCAGTGTCTATGCAGGCAGGTAGGGGGAGGGGGACATCCCGCGTCT FFFFFF,FFFFFFFFFFFFFFFFFFFFFFFF::FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF MC:Z:36S57M PG:Z:bwa-mem2 RG:Z:A00684.1 MQ:i:60
A00684:110:H2TYCDMXY:1:2249:2636:20149 133 NC_000001.11 1029408 0 * = 1029408 0 AGACGCGGGATGTCCCCCTCCCCCTACCTGCCTGCATAGACACTGATGTCCCCCCCAACAAAATGAAATCGAACGGTAGGAATCATACAGAAA FFFFFFFFFFFFF:FFFFFFFFFF:FF:,,FFFFFFFF:F:FF,FFFFF::FFFFF:FFFFFFF:FFF:::FF,,:F,,F,FF,:F,,F,,F, MC:Z:36S57M PG:Z:bwa-mem2 RG:Z:A00684.1 MQ:i:60
A00684:110:H2TYCDMXY:1:2249:2636:20149 155 NC_000001.11 1029408 60 36S57M = 1029408 0 TTTCTGTATGATTCCTACCGTTCGATTTCATTTTGTTGGGGGGGACATCAGTGTCTATGCAGGCAGGTAGGGGGAGGGGGACATCCCGCGTCT ,F,,F,,F:,FF,F,,F:,,FF:::FFF:FFFFFFF:FFFFF::FFFFF,FF:F:FFFFFFFF,,:FF:FFFFFFFFFF:FFFFFFFFFFFFF SA:Z:NT_187425.1,110275,+,56S37M,0,2; MD:Z:52T4 PG:Z:bwa-mem2 RG:Z:A00684.1 NM:i:1 UQ:i:37 AS:i:52
A00684:110:H2TYCDMXY:1:2249:2636:20149 347 NT_187425.1 105480 0 56S37M = 105480 0 AGACGCGGGATGTCCCCCTCCCCCTACCTGCCTGCATAGACACTGATGTCCCCCCCAACAAAATGAAATCGAACGGTAGGAATCATACAGAAC FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF::FFFFFFFFFFFFFFFFFFFFFFFF,FFFFFF SA:Z:NC_000001.11,1029408,+,36S57M,60,1; MD:Z:28G8 PG:Z:bwa-mem2 RG:Z:A00684.1 NM:i:1 UQ:i:37 AS:i:32
A00684:110:H2TYCDMXY:1:2249:2636:20149 395 NT_187425.1 110275 0 56S37M = 110275 0 AGACGCGGGATGTCCCCCTCCCCCTACCTGCCTGCATAGACACTGATGTCCCCCCCAACAAAATGAAATCGAACGGTAGGAATCATACAGAAA FFFFFFFFFFFFF:FFFFFFFFFF:FF:,,FFFFFFFF:F:FF,FFFFF::FFFFF:FFFFFFF:FFF:::FF,,:F,,F,FF,:F,,F,,F, SA:Z:NC_000001.11,1029408,-,36S57M,60,1; MD:Z:28G7C0 PG:Z:bwa-mem2 RG:Z:A00684.1 NM:i:2 UQ:i:36 AS:i:31 -
It looks like you have duplicate copies of your reads where 1 is marked mapped and one is marked unmapped. Did you do anything with your data to cause these duplicates?
What did these specific reads look like before MergeBamAlignment that would cause them to be duplicates?
Please sign in to leave a comment.
14 comments