Genome Analysis Toolkit

Variant Discovery in High-Throughput Sequencing Data

GATK process banner

Need Help?

Search our documentation

Community Forum

Hi, How can we help?

Developed in the Data Sciences Platform at the Broad Institute, the toolkit offers a wide variety of tools with a primary focus on variant discovery and genotyping. Its powerful processing engine and high-performance computing features make it capable of taking on projects of any size. Learn more

GATK Funcotator missing DP and AF information from vcf file

Follow
Avatar
Haiying Kong

I am running Funcotator in gatk-4.1.9.0 to annotate vcf files.

gatk Funcotator \
-R $hg -V ${Lock_VarDict_dir}/$sample.vcf -O ${Result_VarDict_dir}/$sample.maf \
--output-file-format MAF --ref-version hg38 --data-sources-path $Funcotator_DB \
--disable-sequence-dictionary-validation

28 variants out of 5070 variants in maf output missed AF and DP that is clearly stated in vcf file.

For instance, the variant in vcf file:

V1 V2 V3 V4 V5 V6 V7
3377 chr13 28018505 . C A 159 PASS
V8
3377 SAMPLE=Horizon-CMP001;TYPE=SNV;DP=667;VD=37;AF=0.0555;BIAS=2:2;REFBIAS=404:226;VARBIAS=28:9;PMEAN=18.9;PSTD=1;QUAL=30.6;QSTD=1;SBF=0.21433;ODDRATIO=1.7390397022764;MQ=60;SN=11.333;HIAF=0.0529;ADJAF=0.009;SHIFT3=0;MSI=1;MSILEN=1;NM=1.1;HICNT=34;HICOV=643;LSEQ=GTTGGAATCACTCATGATAT;RSEQ=TCGAGCCAATCCAAAGTCAC;DUPRATE=0;SPLITREAD=0;SPANPAIR=0
V9 V10
3377 GT:DP:VD:AD:AF:RD:ALD 0/1:667:37:630,37:0.0555:404,226:28,9

In the maf file from Funcotator output, both DP and AF are NAs.

I would appreciate any help.

0

3 comments

Sort by Date Votes
  • Avatar
    Genevieve Brandt (she/her)

    Hi Haiying Kong,

    Could you please share the stack trace of your funcotator command as well as an example line of the MAF output that is not as expected? We can then look into this and determine if there is an issue.

    See our guidelines for how to write a complete post here: https://gatk.broadinstitute.org/hc/en-us/articles/360053424571-How-to-Write-a-Post

    Genevieve

    0
    Comment actions Permalink
  • Avatar
    Haiying Kong

    Hi Genevieve Brandt

    I have uploaded the rows with missing AF in maf file on:

    https://github.com/Smurf-2020/Funcotator-MAF

    Thank you so much for trying to help me.

    I do not know exactly what stack trace is, but probably:

    13:39:24.863 INFO NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/home/projects/cu_10145/people/haikon/Software/gatk-4.1.9.0/gatk-package-4.1.9.0-local.jar!/com/intel/gkl/native/libgkl_compre
    ssion.so
    Jan 18, 2021 1:39:25 PM shaded.cloud_nio.com.google.auth.oauth2.ComputeEngineCredentials runningOnComputeEngine
    INFO: Failed to detect whether we are running on Google Compute Engine.
    13:39:25.409 INFO Funcotator - ------------------------------------------------------------
    13:39:25.409 INFO Funcotator - The Genome Analysis Toolkit (GATK) v4.1.9.0
    13:39:25.409 INFO Funcotator - For support and documentation go to https://software.broadinstitute.org/gatk/
    13:39:25.409 INFO Funcotator - Executing as haikon@g-01-c0031 on Linux v3.10.0-1062.4.1.el7.x86_64 amd64
    13:39:25.409 INFO Funcotator - Java runtime: OpenJDK 64-Bit Server VM v1.8.0_152-release-1056-b12
    13:39:25.410 INFO Funcotator - Start Date/Time: January 18, 2021 1:39:24 PM CET
    13:39:25.410 INFO Funcotator - ------------------------------------------------------------
    13:39:25.410 INFO Funcotator - ------------------------------------------------------------
    13:39:25.410 INFO Funcotator - HTSJDK Version: 2.23.0
    13:39:25.410 INFO Funcotator - Picard Version: 2.23.3
    13:39:25.410 INFO Funcotator - HTSJDK Defaults.COMPRESSION_LEVEL : 2
    13:39:25.410 INFO Funcotator - HTSJDK Defaults.USE_ASYNC_IO_READ_FOR_SAMTOOLS : false
    13:39:25.410 INFO Funcotator - HTSJDK Defaults.USE_ASYNC_IO_WRITE_FOR_SAMTOOLS : true
    13:39:25.410 INFO Funcotator - HTSJDK Defaults.USE_ASYNC_IO_WRITE_FOR_TRIBBLE : false
    13:39:25.410 INFO Funcotator - Deflater: IntelDeflater
    13:39:25.410 INFO Funcotator - Inflater: IntelInflater
    13:39:25.410 INFO Funcotator - GCS max retries/reopens: 20
    13:39:25.410 INFO Funcotator - Requester pays: disabled
    13:39:25.410 INFO Funcotator - Initializing engine
    13:39:25.811 INFO FeatureManager - Using codec VCFCodec to read file file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/Lock/SNV_InDel/VarDict/Default/Horizon-CMP001.vcf
    13:39:25.845 INFO Funcotator - Done initializing engine
    13:39:25.845 INFO Funcotator - Skipping sequence dictionary validation.
    13:39:25.846 INFO Funcotator - Processing user transcripts/defaults/overrides...
    13:39:25.846 INFO Funcotator - Initializing data sources...
    13:39:25.848 INFO DataSourceUtils - Initializing data sources from directory: /home/projects/cu_10145/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s
    13:39:25.865 INFO DataSourceUtils - Data sources version: 1.7.2020429s
    13:39:25.865 INFO DataSourceUtils - Data sources source: ftp://gsapubftp-anonymous@ftp.broadinstitute.org/bundle/funcotator/funcotator_dataSources.v1.7.20200429s.tar.gz
    13:39:25.865 INFO DataSourceUtils - Data sources alternate source: gs://broad-public-datasets/funcotator/funcotator_dataSources.v1.7.20200429s.tar.gz
    13:39:25.922 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/oreganno.tsv -> file:///home/projects/cu_10145/people/haikon/
    Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/oreganno/hg38/oreganno.tsv
    13:39:25.944 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/hgnc_download_Nov302017.tsv -> file:///home/projects/cu_10145
    /people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/hgnc/hg38/hgnc_download_Nov302017.tsv
    13:39:25.952 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/hg38_All_20180418.vcf.gz -> file:///home/projects/cu_10145/pe
    ople/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/dbsnp/hg38/hg38_All_20180418.vcf.gz
    13:39:25.957 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/Familial_Cancer_Genes.no_dupes.tsv -> file:///home/projects/c
    u_10145/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/familial/hg38/Familial_Cancer_Genes.no_dupes.tsv
    13:39:25.960 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/gencode.v34.annotation.REORDERED.gtf -> file:///home/projects
    /cu_10145/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/gencode/hg38/gencode.v34.annotation.REORDERED.gtf
    13:39:25.965 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/gencode.v34.pc_transcripts.fa -> file:///home/projects/cu_101
    45/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/gencode/hg38/gencode.v34.pc_transcripts.fa
    13:39:25.967 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/simple_uniprot_Dec012014.tsv -> file:///home/projects/cu_1014
    5/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/simple_uniprot/hg38/simple_uniprot_Dec012014.tsv
    13:39:25.977 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/achilles_lineage_results.import.txt -> file:///home/projects/
    cu_10145/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/achilles/hg38/achilles_lineage_results.import.txt
    13:39:25.993 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/gencode_xrefseq_v90_38.tsv -> file:///home/projects/cu_10145/
    people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/gencode_xrefseq/hg38/gencode_xrefseq_v90_38.tsv
    13:39:26.013 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/cosmic_tissue.tsv -> file:///home/projects/cu_10145/people/ha
    ikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/cosmic_tissue/hg38/cosmic_tissue.tsv
    13:39:26.038 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/gencode_xhgnc_v90_38.hg38.tsv -> file:///home/projects/cu_101
    45/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/gencode_xhgnc/hg38/gencode_xhgnc_v90_38.hg38.tsv
    13:39:26.057 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/cosmic_fusion.tsv -> file:///home/projects/cu_10145/people/ha
    ikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/cosmic_fusion/hg38/cosmic_fusion.tsv
    13:39:26.069 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/clinvar_20180429_hg38.vcf -> file:///home/projects/cu_10145/p
    eople/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/clinvar/hg38/clinvar_20180429_hg38.vcf
    13:39:26.084 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/Cosmic.db -> file:///home/projects/cu_10145/people/haikon/Ref
    erence/Funcotator/funcotator_dataSources.v1.7.20200521s/cosmic/hg38/Cosmic.db
    13:39:26.085 INFO Funcotator - Finalizing data sources (this step can be long if data sources are cloud-based)...
    13:39:26.085 INFO DataSourceUtils - Setting lookahead cache for data source: Oreganno : 100000
    13:39:26.089 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/oreganno.tsv -> file:///home/projects/cu_10145/people/haikon/
    Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/oreganno/hg38/oreganno.tsv
    13:39:26.091 INFO FeatureManager - Using codec XsvLocatableTableCodec to read file file:///home/projects/cu_10145/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/oreganno/hg38/oreganno.
    config
    13:39:26.160 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/oreganno.tsv -> file:///home/projects/cu_10145/people/haikon/
    Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/oreganno/hg38/oreganno.tsv
    13:39:26.166 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/oreganno.tsv -> file:///home/projects/cu_10145/people/haikon/
    Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/oreganno/hg38/oreganno.tsv
    WARNING 2021-01-18 13:39:26 AsciiLineReader Creating an indexable source for an AsciiFeatureCodec using a stream that is neither a PositionalBufferedStream nor a BlockCompressedInputStream
    13:39:26.176 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/hgnc_download_Nov302017.tsv -> file:///home/projects/cu_10145
    /people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/hgnc/hg38/hgnc_download_Nov302017.tsv
    13:39:26.316 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/hg38_All_20180418.vcf.gz -> file:///home/projects/cu_10145/pe
    ople/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/dbsnp/hg38/hg38_All_20180418.vcf.gz
    13:39:26.316 INFO DataSourceUtils - Setting lookahead cache for data source: dbSNP : 100000
    13:39:26.342 INFO FeatureManager - Using codec VCFCodec to read file file:///home/projects/cu_10145/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/dbsnp/hg38/hg38_All_20180418.vcf.gz
    13:39:26.489 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/hg38_All_20180418.vcf.gz -> file:///home/projects/cu_10145/pe
    ople/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/dbsnp/hg38/hg38_All_20180418.vcf.gz
    13:39:26.630 INFO FeatureManager - Using codec VCFCodec to read file file:///home/projects/cu_10145/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/dbsnp/hg38/hg38_All_20180418.vcf.gz
    13:39:26.722 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/Familial_Cancer_Genes.no_dupes.tsv -> file:///home/projects/c
    u_10145/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/familial/hg38/Familial_Cancer_Genes.no_dupes.tsv
    13:39:26.730 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/gencode.v34.annotation.REORDERED.gtf -> file:///home/projects
    /cu_10145/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/gencode/hg38/gencode.v34.annotation.REORDERED.gtf
    13:39:26.730 INFO DataSourceUtils - Setting lookahead cache for data source: Gencode : 100000
    13:39:26.795 INFO FeatureManager - Using codec GencodeGtfCodec to read file file:///home/projects/cu_10145/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/gencode/hg38/gencode.v34.annot
    ation.REORDERED.gtf
    13:39:26.828 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/gencode.v34.pc_transcripts.fa -> file:///home/projects/cu_101
    45/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/gencode/hg38/gencode.v34.pc_transcripts.fa
    13:39:31.916 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/simple_uniprot_Dec012014.tsv -> file:///home/projects/cu_1014
    5/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/simple_uniprot/hg38/simple_uniprot_Dec012014.tsv
    13:39:31.953 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/achilles_lineage_results.import.txt -> file:///home/projects/
    cu_10145/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/achilles/hg38/achilles_lineage_results.import.txt
    13:39:31.956 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/gencode_xrefseq_v90_38.tsv -> file:///home/projects/cu_10145/
    people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/gencode_xrefseq/hg38/gencode_xrefseq_v90_38.tsv
    13:39:32.203 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/cosmic_tissue.tsv -> file:///home/projects/cu_10145/people/ha
    ikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/cosmic_tissue/hg38/cosmic_tissue.tsv
    13:39:32.219 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/gencode_xhgnc_v90_38.hg38.tsv -> file:///home/projects/cu_101
    45/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/gencode_xhgnc/hg38/gencode_xhgnc_v90_38.hg38.tsv
    13:39:32.801 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/cosmic_fusion.tsv -> file:///home/projects/cu_10145/people/ha
    ikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/cosmic_fusion/hg38/cosmic_fusion.tsv
    13:39:32.810 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/clinvar_20180429_hg38.vcf -> file:///home/projects/cu_10145/p
    eople/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/clinvar/hg38/clinvar_20180429_hg38.vcf
    13:39:32.810 INFO DataSourceUtils - Setting lookahead cache for data source: ClinVar_VCF : 100000
    13:39:32.813 INFO FeatureManager - Using codec VCFCodec to read file file:///home/projects/cu_10145/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/clinvar/hg38/clinvar_20180429_hg38.vc
    f
    13:39:32.898 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/clinvar_20180429_hg38.vcf -> file:///home/projects/cu_10145/p
    eople/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/clinvar/hg38/clinvar_20180429_hg38.vcf
    13:39:32.968 INFO FeatureManager - Using codec VCFCodec to read file file:///home/projects/cu_10145/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s/clinvar/hg38/clinvar_20180429_hg38.vc
    f
    13:39:33.023 INFO DataSourceUtils - Resolved data source file path: file:///home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/temp/Cosmic.db -> file:///home/projects/cu_10145/people/haikon/Ref
    erence/Funcotator/funcotator_dataSources.v1.7.20200521s/cosmic/hg38/Cosmic.db
    13:39:33.081 INFO Funcotator - Initializing Funcotator Engine...
    13:39:33.082 INFO FuncotatorEngine - Using given VCF and Reference. No conversion required.
    13:39:33.090 INFO Funcotator - Creating a MAF file for output: file:/home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/Result/SNV_InDel/VarDict/Default/Horizon-CMP001.maf
    13:39:33.163 INFO ProgressMeter - Starting traversal
    13:39:33.163 INFO ProgressMeter - Current Locus Elapsed Minutes Variants Processed Variants/Minute
    13:41:34.754 INFO ProgressMeter - chr4:156597944 2.0 1000 493.5
    13:42:57.044 INFO ProgressMeter - chr7:152230205 3.4 2000 588.6
    13:44:46.818 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr10:87893066-87893066 due to alternate allele: <DEL>
    13:45:23.444 INFO ProgressMeter - chr11:119293967 5.8 3000 513.9
    13:46:00.669 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr13:28033908-28033908 due to alternate allele: <DUP>
    13:46:01.029 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr13:28033909-28033909 due to alternate allele: <DUP>
    13:46:01.495 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr13:28033910-28033910 due to alternate allele: <DUP>
    13:46:42.695 INFO ProgressMeter - chr16:50152895 7.2 4000 558.7
    13:47:25.673 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr19:12877799-12877799 due to alternate allele: <DUP>
    13:47:25.675 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr19:12877799-12877799 due to alternate allele: <DUP>
    13:47:29.379 WARN CosmicFuncotationFactory - Warning - unable to parse protein string due to invalid position information. Ignoring potential COSMIC match with protein sequence: p.V308_P39insDKAKQRNV
    13:47:29.427 WARN CosmicFuncotationFactory - Warning - unable to parse protein string due to invalid position information. Ignoring potential COSMIC match with protein sequence: p.V308_P39insV
    13:47:29.723 WARN CosmicFuncotationFactory - Warning - unable to parse protein string due to invalid position information. Ignoring potential COSMIC match with protein sequence: p.V308_P39insDKAKQRNV
    13:47:29.773 WARN CosmicFuncotationFactory - Warning - unable to parse protein string due to invalid position information. Ignoring potential COSMIC match with protein sequence: p.V308_P39insV
    13:47:30.109 WARN CosmicFuncotationFactory - Warning - unable to parse protein string due to invalid position information. Ignoring potential COSMIC match with protein sequence: p.V308_P39insDKAKQRNV
    13:47:30.159 WARN CosmicFuncotationFactory - Warning - unable to parse protein string due to invalid position information. Ignoring potential COSMIC match with protein sequence: p.V308_P39insV
    13:47:30.498 WARN CosmicFuncotationFactory - Warning - unable to parse protein string due to invalid position information. Ignoring potential COSMIC match with protein sequence: p.V308_P39insDKAKQRNV
    13:47:30.548 WARN CosmicFuncotationFactory - Warning - unable to parse protein string due to invalid position information. Ignoring potential COSMIC match with protein sequence: p.V308_P39insV
    13:47:30.880 WARN CosmicFuncotationFactory - Warning - unable to parse protein string due to invalid position information. Ignoring potential COSMIC match with protein sequence: p.V308_P39insDKAKQRNV
    13:47:30.927 WARN CosmicFuncotationFactory - Warning - unable to parse protein string due to invalid position information. Ignoring potential COSMIC match with protein sequence: p.V308_P39insV
    13:48:10.435 INFO ProgressMeter - chrX:40074374 8.6 5000 580.0
    13:48:15.362 INFO ProgressMeter - chrX:40074374 8.7 5164 593.3
    13:48:15.362 INFO ProgressMeter - Traversal complete. Processed 5164 total variants in 8.7 minutes.
    13:48:15.362 INFO VcfFuncotationFactory - ClinVar_VCF 20180429_hg38 cache hits/total: 0/341
    13:48:15.362 INFO VcfFuncotationFactory - dbSNP 9606_b151 cache hits/total: 0/4505
    13:48:16.943 INFO Funcotator - Shutting down engine
    [January 18, 2021 1:48:16 PM CET] org.broadinstitute.hellbender.tools.funcotator.Funcotator done. Elapsed time: 8.87 minutes.
    Runtime.totalMemory()=2863136768
    Using GATK jar /home/projects/cu_10145/people/haikon/Software/gatk-4.1.9.0/gatk-package-4.1.9.0-local.jar
    Running:
    java -Dsamjdk.use_async_io_read_samtools=false -Dsamjdk.use_async_io_write_samtools=true -Dsamjdk.use_async_io_write_tribble=false -Dsamjdk.compression_level=2 -jar /home/projects/cu_10145/people/haikon/Soft
    ware/gatk-4.1.9.0/gatk-package-4.1.9.0-local.jar Funcotator -R /home/projects/cu_10145/people/haikon/Reference/GATK/hg38/Homo_sapiens_assembly38.fasta -V /home/projects/cu_10145/people/haikon/Project/PTH/BatchWo
    rk/Batch001/Lock/SNV_InDel/VarDict/Default/Horizon-CMP001.vcf -O /home/projects/cu_10145/people/haikon/Project/PTH/BatchWork/Batch001/Result/SNV_InDel/VarDict/Default/Horizon-CMP001.maf --output-file-format MAF
    --ref-version hg38 --data-sources-path /home/projects/cu_10145/people/haikon/Reference/Funcotator/funcotator_dataSources.v1.7.20200521s --disable-sequence-dictionary-validation

    0
    Comment actions Permalink
  • Avatar
    Genevieve Brandt (she/her)

    Hi Haiying Kong,

    Thank you for your patience as we look into this issue. Could you provide examples of input data that do not have the AF/DP fields in the MAF and examples that do have the AF/DP fields? This will help us to recreate the issue and figure out what is happening.

    Thank you,

    Genevieve

    0
    Comment actions Permalink

Please sign in to leave a comment.

Welcome

Forum Guidelines

GATK Announcements

Become a GATK Guru

Read Before You Post

Get Email Notifications

Didn't find what you were looking for?

New post

Quick Links

GATK Latest Releases

Known Issues & Troubleshooting

Submitting a Bug Report

How to Track a Github issue

GATK on the Cloud with Terra

Recent GATK News

GATK Blog Posts

GATK Twitter Page

About the GATK community

  • 133,119 Total Users
  • 0 Comments
  • 0 Posts
  • 0 Votes
Powered by Zendesk