Genome Analysis Toolkit

Variant Discovery in High-Throughput Sequencing Data

GATK process banner

Need Help?

Search our documentation

Community Forum

Hi, How can we help?

Developed in the Data Sciences Platform at the Broad Institute, the toolkit offers a wide variety of tools with a primary focus on variant discovery and genotyping. Its powerful processing engine and high-performance computing features make it capable of taking on projects of any size. Learn more

Clear missing variant from HaplotypeCaller

0

9 comments

  • Avatar
    Genevieve Brandt

    Hello Edu Andrés León,

    Check out some of our resources that can help figure out why you are seeing this:

    0
    Comment actions Permalink
  • Avatar
    Edu Andrés León

    Dear Genevieve

    I'm rerunning the HaplotypeCaller with the options suggested in your first post. The others did not answer what I'm seeing in this analysis.

    Thanks for your help. Once it finished, I'll let you know

    Cheers

    0
    Comment actions Permalink
  • Avatar
    Edu Andrés León

    Hi again,

    Finally I have been able to finish reviewing some variants. It is true that many of those I selected no longer appear, but it is true that now others appear and essentially the same thing is happening to me, I see some that for me are clear, but they do not appear marked in both patients.

    Here is one example:

    0
    Comment actions Permalink
  • Avatar
    Genevieve Brandt

    Hi Edu Andrés León, thank you for posting an update. Could you answer these follow up questions?

    1. Are these genomes or exomes? 
    2. What method did you use to get this data? Was this from PCR amplified data or PCR-free?
    3. Could you look at the pileup and see if this occurs there? Or, is this a result of GATK re-assembly?
    0
    Comment actions Permalink
  • Avatar
    Edu Andrés León

    Hi Genevieve, thanks again for your help. These are the answers:

    1) Whole genome

    2) PCR amplified 

    3) The picture was made using bam files from the --bam-output parameter by the HaplotypeCaller 

    The mpileup from this position in this bam file is:

    [mpileup] 2 samples in 1 input files

    chr1    125178240       N       3946    GAGGGGAGGGGAGAAAAGGGGGGAAGGAAAAGGGGAAGAGAGAGGAAAGGAAAAAAAGAGGAAGGAAGAGAGGGGGAGGGGGGGGGGGGGGGGGGGGAAG$GAGAGGAAAAAGGAGGAAGGAGGGGGGAGAGGAGGGAGGAAGGAGGGGAGACGGA$GGGAGGGAGG$GAGAGGGAGGGGAGAAAGAGACAGGGAGGAGAAGAGGGAAA$AGGGGGAGGAAAGGAGAAGGAAGG$GAGGGGAGGAGAAGGGGGGGGGGAAGAAGAGAGAGGAAAGAAGAAGAGGGAGGAGGGGAGGGGAAAAGG$AAGAGAAGAAAAGGGGAAAAGAAAAGAGGGGGGGGGAAGAGAAGGGGAGGGGGGAGGAGAGAGAGGAGGAGAGAGAAGGGGGGGGGGGAGGGGGAAGGGGGGGAAGAAGGGGAAGGGGAGAGGCAAGGGAAGGAAGAGAAGGGGGAGGAAGGGGAAG$GGGGGGGAAAGGGGGGAAGGGGGGGAGAG$AAGGGGGGAAAAGGGGAGGAGGGGAGGAGGAAAGGGAAAGGGGGGAAGGGGGAGGAGAGAGGGGGAGGAGGGGGGAAGAGGGGGGGGGGGAGGGGGGGAAAAGAGGAGAGAAGGGAAGGGGGGAGGGGGGGGAGGGGAGGGGAGGAGGAAGAGGGAGGGAGGAAGGGAAGGAGAAGGAAAGAAAGGGGGGGGGGAGGGG$GAGAGAAGGAGAGGGAGGGGGAGGAGGAGGAAGGGGG$GAGAGAGGAGAAGGAAAAAAAAGAAGGGAGAGGAAAAAGGGGGGAGGGAAAGAAGAGG$GAAGGGGAAGGGGAGAAGAGGGAGGAAGGGGAGGGGGAAGGAGGGGGAGGAAGGG$GAAAAAAGGGGGGAAGAAAGAAGGGG$GGGGGGGGGGGAGGAGGGGGGAGGA$GGGGGGGGAGGAAAGAAG$GAGAAGAGGGAGGGAGGAGGGAGGAGGAGGGGAGGGGGAGGGAAGAGGA$GGAGGGGGAGGAGGGGGGGAGAGGAAAAGAGGGGGGGAGAAGAAAAGGAA$GGGAGGGGGGGGGAGAGGGGAGGGAAAGGAGAGAGGGAGAGGGGGAGAGGAAGAAGAGGAGAGAA$GGGGGAAAAGGGGGAAGAGGGGAAAGAGGAAGAGGGGAAGGGGGAGGGAGGAAAGGGGGAGGGGGAGGgggggaaagaagaaaaggggggaagggaaagagggagaggagggaggaaagaggggagg$ggaa$ggagagaagaggggggaggggggagggaggaagggaggaggggaagggggggggaggggggaagggggaaagggaaaggaaggagagggggagaaaagggaggggggagaaaagagagggagaaaggggagagagggagaaaggagagaggggggaaggaggggagaggggagggaggaagggagggaggggggggagggagggagaga$gggggggggggggaaaaggagaagaagagggggaaaaggagagagggggaaagaagggggggaaagggagggggaaggaggaaggggagaagggagggagagggagaaggagggggaggaagagggaagggagggggggagggggggggggggagggagggaggaggagaggggggggggggaaaggagagagggggaggaagggaggggagggagagagagagagggaaagggggggg$ggg$ggaaaggagggaggaaggggggaggagggaaaggagagaaggggggggggaggaaggaggagg$ggaaagggagaggggggagg$aagggggggagaacgagagagaggggggggaaaggaaaaaggggaaggggggaaggagaggaggagaagaggggggggggagaagggaagggggggaaaaggaaaggagggggagagagggaggggggaaggaggggggggggggggggaaaggggaaaagaagggaaggggaggagggagaggagaaaag$aggggggaggggagagagaggggggaaggaaaggggaggaggggaggagggggaggagggaaggagaaaagggggaaggagggggggagagaagagggaaggaggaggggagagaaggagagagagggggaggagaggaaagaaaaaagggagaaggggcagaagggagag$ggggagaaggggagaggggagggaggggagggaggagggggaagagaggaaggaagaggggaaggg$ggggggggggggggggagagaggagaaggagggggggagaggggaggggaagagaggggggggagagaaggggggaaggagagaaggaaagaggggggggaaggagggagaaaggagagggggaggaggaggaggaaaggaagggaaaagaggggggggggggggggggggaggggggagaAAGGGGGGAGgaaGGGAAGGGAGggggggaaaggaggaAGAGGAGAGAGagaagaaggagggaaaaggGGAAGAAAGGGGAGGGggagaagggagagaGGAGGGAAGAAAGgaaggGAGGGAgaaaggggggAAAAGGAAGGAGAaggggagagaggaGGAGGAAGAGGAaaaggggggggggagaagaggggaAAGGGAGGGGgggaggagggagaggaggagggagggaagaagagGGAGGGGGGAAGGAGAAAAGGGaagaggggaggAAAAAGGGgggagagggGGGGAGGggaaaaagaggaGGGGGGAGGGGAagagggaagAGGGAGAGAAGAAAAggggggaggggGGGAAAAGAAGAGGAGGAGGAgaagggagaggaaAAGGgaaaagGGAgggggggagaggggaggaGGGGGAAAAGAAAGGGGaggggagaggggggagggGGGGGAAGGGGAAGggggaggggggGAGGGGAGGAgggaaggaggaGGGGGGGAAgggaaggggggaaaGGGGGGGGGAGGAAGAAGGagggagggagAGGGAGAGGGAGGGGAGAGGGAaggaggggaaaaaggAGGAGGGGAggaggggggaggggaAAGGAAGAGGgagggagaggagggggagGAGGAGAGAGGGgaggggagggggGGAAGGAGAAGGGCGAGGGGGAGAaggagggggaggGAGGGGAGGAGAGGGAAGGAAGGAGgaggagagaggGAAaagcGGGGGGGAGAggagagagggGGGGGAAGAGGAaagggaagggGGGGAAAAGGGAGGGAGGGGGGGAGGGGAGGGggggagaGACGGGAAGAGGGGGAGGGagagagAGGAAGAAGAAAgaggaggaGAAGGGAAGGagggggaggagggagagaGGGAGaagggGGGAGAGaggAGGGGGGgagggaggggaggagGaaaaggagGGggggaaggagGGGaagagggggaaggggggaGGaaaggagaGGGGGagggGGGGGggggggagggGGGGGGGGGGagagaagggaggaggGGGGGGGGgggggggggggggGGGGGGGGGGaggagaggggggggggGGGGGGGGGGGGGGGGggagaggggggggagggggGGGGGGGGGGGgaggggaagggaaaggagggggggGGGGGGGGGGggggggaggaaagggggggggggGGGGGGGGagggggggggggaaggggaGGGGGGAGGGGGgagggggaagagagggggGGGGGGGGGGGaggaggggagggggggggagggaGGGGGGGGGGGGGGggagaaagagagggggagaaggGGGGGaagagggaaagaggggggggaGGGGaaaagGGGGGGGgaggaggggggggGGGGGGGGGGGGGGGGGGGGGgggagggaggGGGGGgggggggggaaagggGGGGGGGGgaagaagaggggggagaagagggGGGGGagaggaggaaggggGGGGGagagggggggggggaGGgaggaggggaaaaggaagagGGagagagaggggaggggggggggaggagGGgaaggaagcgaggggGGggggggggGGgagggggaggggaaa^<G^:G^:G^Ng^\a^Qg^?g^Na^Zg^<g^Da^Na^Bg^>a^Qg^:a    FFFFFF5F:FFFFFF5FFFFFFFFFFFFFFF5FFFFF:FFFFFFFF55FFFFFFFFFFFF:FFFFFFFFFFF5FFFFFF5FFF:F5F:FFFFFFF:FFF:FFFFFFFFFFFFFFFFFFFFF5:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF5FFFFFFFFF:FFFFFF:FFFFF5FFFFF5F:F:FFFFFFFFFFFF5FFFF:FF5FFFFFFFFFFFFFFFFFFFF5FFFFFFFFFFFFFF5FFFFFFFFF5FFFFFF:FFF5FFFFFFFFFFFFFFFFFFF:F:FF:FFFFFFFFFFFF5FF:FFFFFFFFFFFFFFFFFFFFF:FF:F5FFF:F:FFFFFF5FFF:FFFFFFFFFFFFFFFFFFF:FFFF:FFFFFFFF5FFFFFF::FFFFFFFFF:F5F5FFFFFF:F5FFFFF:FFFFFFFFFF5FFFFFFF5FFFFF5F:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFIFFFF5F:FFFFFFFFFFFFFFFF:F:FFFFFFFF:FFFFFF5FFFFFFFFFFFFFFFFFFF:5FFFFFFFFF:FF5FFFFFFFF5FFFFFFFFFFFFFFFFFFFFFFFFF:FFFF5FFFFF5F:FFFFFFFFFFFFFFFF5FF5FFFFFFFFFFFF5FFFFF5F:FFFFFFFF5:FFFFFFFF5FFFFF::FFF5FFFFFF:FFFF5FFFF:FF:FFFFFFFFFFFFFFFFFFFFF55FFFF:F:FFFFFFFF5:FFF5FFFF:FF:FFFFFF:FFF5FFFFFFFFFFFFFFFF55FFFF:5FFFFFFFFFFFFFFFFFFFFIFFFF5FFFFFFFFI5F5FFFFFFFFFFFF:FFFFFF5FFFFFFFFFFIF5FFFFFFFFFF:FFFF:FF:FF:FFF5FF5FFFFFFFFFFFFF:FFF:FFFFFFFFFFFFFFFFFFFFFF:FF:FFFIFF5F:FFFFFFF5FFFFFFIFFFFFFFFFFFFF5FFFFFFFFFFFFFFF5:FFFFFFFFFFFFF5FFFFFFFFFFFFFFFFFF5FFFFFFFFFFFFF5FIFFFFFFFFFFFFFFFFFFFFFFFFFFF5FF:F:FF5FFFFFFFFFFFFFFFF:FFFFFFFFFFFF:FFIFFFFFFFFFFF:5FFFFFFFFFF5FFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFF5:FFFFFFFFFFF:FFFFFFFFFFFFFFF5FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFF5FF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFF5F5FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFF5FFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFF5FFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF5FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFF:FFFFFFFFFFFFFFFFFFFF:BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF5FFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFF:FFFFFF:5FFFF5FFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFF5FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF5FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFIFFFFFFFFFFFFFFFF:FFFFFFFFFFF5FFFFFFFFFFF:FFFFF:FFF:FFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFF:FFFF:FFFFFFFFFFFFFFFFF:FFFFFF5:FFFFFF5FFFFFFFFFFFFFFFF:FFFFFFFFFFF5FF:FFFFFF:FFFFFFFF:FFFFFFFFFFFF:FFFFFFFFFFFF5IFFFFFFFFFFFFFFFFFFFFF5FF5FFFFFFFFFFFFFFFFFFFFF5FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFF5:FFFFFFFFFFFFFFFFFFF::FFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:5FF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF5FFFFFFFF:FFFFFFFFFFFFF5FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF5FFFFFFFFFFFFF5FFF:FFFFFFF:FFF5FFFFFFF55FFFFFFFF5FFFFFFFFF:FFFFFFFFFFFFFFFFF5F:5FFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFF5FFFF5FFFFFFFFFFFFFFFFFFFFFFFFF5FFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFF5FFFFF5FF:FFF5FFF:FFFFFFFFFFFFFFFFFFFFF5:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF55FFFFFFFFFFFFFFFFFFFFFF5FFFF:5F:FF:FFFFFFFFFF5FF5FFFFFF:FF:FF:FFFFFFFFFF:FFFFFFFFFFFF5F:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF5FFFFFFFFFFFFFFFF:F:F5FFFFFFFFFFFFFFFFF:5FFFFFF:FFFFFFF5FFFFFFFFF:FFF5FFFFF:FFFFFFFFF5FFF5F:FFFF:FFF5FFFF5FF::F5FF:FFFFFFFF:FFF5FFFF:F5FF55FFFFFFFFFFFF:F5FFFF:FFFFF5FFFFFF:FFFFFFFFFF:FFF5F5FF5FFFFFFFFFFFFFF5F

     And what I see in the gvcf file is:

    Sample1:

    chr1    125178240       .       G       A,<NON_REF>     38033.64        .       BaseQRankSum=-4.969;DP=4076;ExcessHet=3.0103;MLEAC=1,0;MLEAF=0.500,0.00;MQRankSum=-2.250;RAW_MQandDP=6413694,4076;ReadPosRankSum=4.257  GT:AD:DP:GQ:PL:SB       0/1:2683,1317,2:4002:99:38041,0,101158,46110,105099,151208:1262,1421,619,700

    Sample2: 

    chr1       125178240       .       G       <NON_REF>       .       .       END=125178240   GT:DP:GQ:MIN_DP:PL      0/0:3024:0:3024:0,0,59823

     

    I hope this can help

     

    0
    Comment actions Permalink
  • Avatar
    Genevieve Brandt

    Edu Andrés León Thank you, I will let you know when I have more information.

    0
    Comment actions Permalink
  • Avatar
    Edu Andrés León

    Thanks in advance. Please let me know if you need more examples like this one, I have a bunch 

    0
    Comment actions Permalink
  • Avatar
    Genevieve Brandt

    Edu Andrés León could you submit multiple of these examples in a bug report following these instructions?

    0
    Comment actions Permalink
  • Avatar
    Genevieve Brandt

    Hi Edu Andrés León, there is another option for debugging these sites. Please check out --debug-assembly-region-state. You will want to target just this site because it will output a dot file for the assembly graph at each step of the process. You can use these files to determine what is going wrong.

    0
    Comment actions Permalink

Please sign in to leave a comment.

Powered by Zendesk