Genome Analysis Toolkit

Daniel Rodden · June 18, 2024 15:45

As Funcotator finished successfully are the above errors a problem for further analysis? What steps would you recommend for addressing the Error and Warn messages?

Thank you for your help!

REQUIRED for all errors and issues:
a) GATK version used: gatk/4.2.6.1

b) Exact command used:

gatk --java-options "-Xmx4G" Funcotator \

--variant ${results}/${filename}_analysis-ready-snps-filteredGT.vcf \

--reference ${ref} \

--ref-version hg19 \

--data-sources-path ${data_sources} \

--output ${results}/${filename}_analysis_ready_snps_filteredGT_funcotated.vcf \

--output-file-format VCF

c) Entire program log:

java -Dsamjdk.use_async_io_read_samtools=false -Dsamjdk.use_async_io_write_samtools=true -Dsamjdk.use_async_io_write_tribble=false -Dsamjdk.compression_level=2 -Xmx4G -jar /apps/lib/gatk/4.2.6.1/gatk-package-4.2.6.1-local.jar Funcotator --variant ../results/S-112-2_analysis-ready-indels-filteredGT.vcf --reference ../../references/hg19-v0-Homo_sapiens_assembly19.fasta --ref-version hg19 --data-sources-path ../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g --output ../results/S-112-2_analysis_ready_indels_filteredGT_funcotated.vcf --output-file-format VCF

13:20:48.656 INFO NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/apps/lib/gatk/4.2.6.1/gatk-package-4.2.6.1-local.jar!/com/intel/gkl/native/libgkl_compression.so

13:20:49.749 INFO Funcotator - ------------------------------------------------------------

13:20:49.751 INFO Funcotator - The Genome Analysis Toolkit (GATK) v4.2.6.1

13:20:49.751 INFO Funcotator - For support and documentation go to https://software.broadinstitute.org/gatk/

13:20:49.751 INFO Funcotator - Executing as dr019@dn002 on Linux v3.10.0-1160.71.1.el7.x86_64 amd64

13:20:49.752 INFO Funcotator - Java runtime: Java HotSpot(TM) 64-Bit Server VM v20.0.2+9-78

13:20:49.753 INFO Funcotator - Start Date/Time: June 17, 2024, 1:20:48 PM EDT

13:20:49.754 INFO Funcotator - ------------------------------------------------------------

13:20:49.755 INFO Funcotator - HTSJDK Version: 2.24.1

13:20:49.756 INFO Funcotator - Picard Version: 2.27.1

13:20:49.756 INFO Funcotator - Built for Spark Version: 2.4.5

13:20:49.756 INFO Funcotator - HTSJDK Defaults.COMPRESSION_LEVEL : 2

13:20:49.756 INFO Funcotator - HTSJDK Defaults.USE_ASYNC_IO_READ_FOR_SAMTOOLS : false

13:20:49.756 INFO Funcotator - HTSJDK Defaults.USE_ASYNC_IO_WRITE_FOR_SAMTOOLS : true

13:20:49.757 INFO Funcotator - HTSJDK Defaults.USE_ASYNC_IO_WRITE_FOR_TRIBBLE : false

13:20:49.757 INFO Funcotator - Deflater: IntelDeflater

13:20:49.757 INFO Funcotator - Inflater: IntelInflater

13:20:49.757 INFO Funcotator - GCS max retries/reopens: 20

13:20:49.757 INFO Funcotator - Requester pays: disabled

13:20:49.758 INFO Funcotator - Initializing engine

13:20:49.992 INFO FeatureManager - Using codec VCFCodec to read file file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../results/S-112-2_analysis-ready-indels-filteredGT.vcf

13:20:50.009 INFO Funcotator - Done initializing engine

13:20:50.009 INFO Funcotator - Validating sequence dictionaries...

13:20:50.011 INFO Funcotator - Processing user transcripts/defaults/overrides...

13:20:50.011 INFO Funcotator - Initializing data sources...

13:20:50.013 INFO DataSourceUtils - Initializing data sources from directory: ../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g

13:20:50.019 INFO DataSourceUtils - Data sources version: 1.7.2020521g

13:20:50.019 INFO DataSourceUtils - Data sources source: ftp://gsapubftp-anonymous@ftp.broadinstitute.org/bundle/funcotator/funcotator_dataSources.v1.7.20200521g.tar.gz

13:20:50.020 INFO DataSourceUtils - Data sources alternate source: gs://broad-public-datasets/funcotator/funcotator_dataSources.v1.7.20200521.tar.gz

13:20:50.030 INFO DataSourceUtils - Resolved data source file path: file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/acmg59_test_cleaned.txt -> file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g/acmg_rec/hg19/acmg59_test_cleaned.txt

13:20:50.036 INFO DataSourceUtils - Resolved data source file path: file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/clinvar_20180401.vcf -> file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g/clinvar/hg19/clinvar_20180401.vcf

13:20:50.052 INFO DataSourceUtils - Resolved data source file path: file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/acmg_lof.tsv -> file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g/acmg_lof/hg19/acmg_lof.tsv

13:20:50.081 INFO DataSourceUtils - Resolved data source file path: file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/LMM_Path_LP_VUS5-variants-6-12-18.sorted.vcf -> file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g/lmm_known/hg19/LMM_Path_LP_VUS5-variants-6-12-18.sorted.vcf

13:20:50.088 INFO DataSourceUtils - Resolved data source file path: file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/gencode.v34lift37.annotation.REORDERED.gtf -> file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g/gencode/hg19/gencode.v34lift37.annotation.REORDERED.gtf

13:20:50.089 INFO DataSourceUtils - Resolved data source file path: file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/gencode.v34lift37.pc_transcripts.fa -> file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g/gencode/hg19/gencode.v34lift37.pc_transcripts.fa

13:20:50.089 INFO Funcotator - Finalizing data sources (this step can be long if data sources are cloud-based)...

13:20:50.090 INFO DataSourceUtils - Resolved data source file path: file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/acmg59_test_cleaned.txt -> file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g/acmg_rec/hg19/acmg59_test_cleaned.txt

13:20:50.093 INFO DataSourceUtils - Resolved data source file path: file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/clinvar_20180401.vcf -> file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g/clinvar/hg19/clinvar_20180401.vcf

13:20:50.093 INFO DataSourceUtils - Setting lookahead cache for data source: ClinVar_VCF : 100000

13:20:50.096 INFO FeatureManager - Using codec VCFCodec to read file file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g/clinvar/hg19/clinvar_20180401.vcf

13:20:50.302 INFO DataSourceUtils - Resolved data source file path: file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/clinvar_20180401.vcf -> file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g/clinvar/hg19/clinvar_20180401.vcf

13:20:50.542 INFO FeatureManager - Using codec VCFCodec to read file file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g/clinvar/hg19/clinvar_20180401.vcf

13:20:50.662 INFO DataSourceUtils - Resolved data source file path: file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/acmg_lof.tsv -> file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g/acmg_lof/hg19/acmg_lof.tsv

13:20:50.664 INFO DataSourceUtils - Resolved data source file path: file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/LMM_Path_LP_VUS5-variants-6-12-18.sorted.vcf -> file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g/lmm_known/hg19/LMM_Path_LP_VUS5-variants-6-12-18.sorted.vcf

13:20:50.664 INFO DataSourceUtils - Setting lookahead cache for data source: LMMKnown : 100000

13:20:50.668 INFO FeatureManager - Using codec VCFCodec to read file file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g/lmm_known/hg19/LMM_Path_LP_VUS5-variants-6-12-18.sorted.vcf

13:20:50.676 INFO DataSourceUtils - Resolved data source file path: file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/LMM_Path_LP_VUS5-variants-6-12-18.sorted.vcf -> file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g/lmm_known/hg19/LMM_Path_LP_VUS5-variants-6-12-18.sorted.vcf

13:20:50.684 INFO FeatureManager - Using codec VCFCodec to read file file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g/lmm_known/hg19/LMM_Path_LP_VUS5-variants-6-12-18.sorted.vcf

13:20:50.689 INFO DataSourceUtils - Resolved data source file path: file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/gencode.v34lift37.annotation.REORDERED.gtf -> file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g/gencode/hg19/gencode.v34lift37.annotation.REORDERED.gtf

13:20:50.689 INFO DataSourceUtils - Setting lookahead cache for data source: Gencode : 100000

13:20:50.693 INFO FeatureManager - Using codec GencodeGtfCodec to read file file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g/gencode/hg19/gencode.v34lift37.annotation.REORDERED.gtf

13:20:50.727 INFO DataSourceUtils - Resolved data source file path: file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/gencode.v34lift37.pc_transcripts.fa -> file:///PHShome/dr019/prostate_wes/GATK/GATK_workflow/../GATK_funcotator_data/funcotator_dataSources.v1.7.20200521g/gencode/hg19/gencode.v34lift37.pc_transcripts.fa

13:20:53.428 INFO Funcotator - Initializing Funcotator Engine...

13:20:53.436 INFO FuncotatorEngine - VCF sequence dictionary detected as B37 in HG19 annotation mode. Performing conversion.

13:20:53.436 WARN FuncotatorEngine - WARNING: You are using B37 as a reference. Funcotator will convert your variants to GRCh37, and this will be fine in the vast majority of cases. There MAY be some errors (e.g. in the Y chromosome, but possibly in other places as well) due to changes between the two references.

13:20:53.436 INFO Funcotator - Creating a VCF file for output: file:/PHShome/dr019/prostate_wes/GATK/GATK_workflow/../results/S-112-2_analysis_ready_indels_filteredGT_funcotated.vcf

13:20:53.460 INFO ProgressMeter - Starting traversal

13:20:53.461 INFO ProgressMeter - Current Locus Elapsed Minutes Variants Processed Variants/Minute

13:20:55.108 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000375071.4_2 for variant: chr1:20915589-20915590(TC* -> T): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000375071.4_2 Variant: [VC Unknown @ chr1:20915589-20915590 Q140.60 of type=INDEL alleles=[TC*, T] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=2.285, DP=25, ExcessHet=0.0000, FS=1.897, MLEAC=1, MLEAF=0.500, MQ=61.29, MQRankSum=3.036, QD=6.39, ReadPosRankSum=-1.219, SOR=1.329} GT=GT:AD:DP:GQ:PL 0/1:16,6:22:99:148,0,502 filters=

13:20:55.108 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000375071.4_2 for problem variant: chr1:20915589-20915590(TC* -> T)

13:20:59.345 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=7292, ref allele: TG)

13:20:59.346 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=7445, ref allele: TG)

13:20:59.347 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=6719, ref allele: TG)

13:20:59.347 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=7085, ref allele: TG)

13:20:59.348 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=7037, ref allele: TG)

13:20:59.390 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000652191.1_2 for variant: chr1:145209152-145209155(GGGC* -> G): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000652191.1_2 Variant: [VC Unknown @ chr1:145209152-145209155 Q785.60 of type=INDEL alleles=[GGGC*, G] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=0.448, DP=241, ExcessHet=0.0000, FS=1.502, MLEAC=1, MLEAF=0.500, MQ=50.62, MQRankSum=-5.908, QD=3.71, ReadPosRankSum=-1.424, SOR=0.853} GT=GT:AD:DP:GQ:PL 0/1:179,33:212:99:793,0,7203 filters=

13:20:59.390 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000652191.1_2 for problem variant: chr1:145209152-145209155(GGGC* -> G)

13:20:59.390 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000624419.2_2 for variant: chr1:145209152-145209155(GGGC* -> G): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000624419.2_2 Variant: [VC Unknown @ chr1:145209152-145209155 Q785.60 of type=INDEL alleles=[GGGC*, G] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=0.448, DP=241, ExcessHet=0.0000, FS=1.502, MLEAC=1, MLEAF=0.500, MQ=50.62, MQRankSum=-5.908, QD=3.71, ReadPosRankSum=-1.424, SOR=0.853} GT=GT:AD:DP:GQ:PL 0/1:179,33:212:99:793,0,7203 filters=

13:20:59.391 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000624419.2_2 for problem variant: chr1:145209152-145209155(GGGC* -> G)

13:21:04.866 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=563, ref allele: G)

13:21:04.867 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=974, ref allele: G)

13:21:04.868 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=638, ref allele: G)

13:21:05.482 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=770, ref allele: T)

13:21:05.920 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=659, ref allele: C)

13:21:05.920 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=659, alt allele: CAGCGGCAGCACGAGGTGGTGATGGAGCAGCTGCAGCGGG)

13:21:07.240 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1268, ref allele: T)

13:21:07.929 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000426713.1_2 for variant: chr2:110970389-110970402(GCTCTGTATTTTCT* -> G): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000426713.1_2 Variant: [VC Unknown @ chr2:110970389-110970402 Q38.60 of type=INDEL alleles=[GCTCTGTATTTTCT*, G] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=-0.462, DP=19, ExcessHet=0.0000, FS=0.000, MLEAC=1, MLEAF=0.500, MQ=61.13, MQRankSum=3.886, QD=2.57, ReadPosRankSum=-0.085, SOR=0.223} GT=GT:AD:DP:GQ:PL 0/1:13,2:15:46:46,0,493 filters=

13:21:07.929 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000426713.1_2 for problem variant: chr2:110970389-110970402(GCTCTGTATTTTCT* -> G)

13:21:08.948 INFO ProgressMeter - chr2:152731534 0.3 1000 3874.2

13:21:11.153 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000583251.1 for variant: chr2:211036019-211036031(GGCCGCCGCCGCC* -> G): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000583251.1 Variant: [VC Unknown @ chr2:211036019-211036031 Q590.05 of type=INDEL alleles=[GGCCGCCGCCGCC*, G] attr={AC=2, AF=1.00, AN=2, DP=23, ExcessHet=0.0000, FS=0.000, MLEAC=1, MLEAF=0.500, MQ=62.47, QD=23.46, SOR=0.836} GT=GT:AD:DP:GQ:PL 1/1:0,13:13:41:588,41,0 filters=

13:21:11.153 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000583251.1 for problem variant: chr2:211036019-211036031(GGCCGCCGCCGCC* -> G)

13:21:11.395 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000607946.1_1 for variant: chr2:219498734-219498761(TGGAGAGAAGGGTGAAGAGTAGGCATGG* -> T): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000607946.1_1 Variant: [VC Unknown @ chr2:219498734-219498761 Q94.60 of type=INDEL alleles=[TGGAGAGAAGGGTGAAGAGTAGGCATGG*, T] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=-1.645, DP=11, ExcessHet=0.0000, FS=6.264, MLEAC=1, MLEAF=0.500, MQ=60.00, MQRankSum=0.000, QD=8.60, ReadPosRankSum=0.000, SOR=2.833} GT=GT:AD:DP:GQ:PL 0/1:8,3:11:99:102,0,327 filters=

13:21:11.395 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000607946.1_1 for problem variant: chr2:219498734-219498761(TGGAGAGAAGGGTGAAGAGTAGGCATGG* -> T)

13:21:12.088 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2456, ref allele: C)

13:21:12.089 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2456, ref allele: C)

13:21:13.128 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1748, ref allele: GTAAGA)

13:21:13.129 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1436, ref allele: GTAAGA)

13:21:13.130 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1748, ref allele: CGCGCCGA)

13:21:13.130 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1436, ref allele: CGCGCCGA)

13:21:13.278 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=2164, ref allele: GC)

13:21:13.298 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=3137, ref allele: T)

13:21:13.298 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=3428, ref allele: T)

13:21:13.298 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=3152, ref allele: T)

13:21:14.108 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000296121.6_3 for variant: chr3:44803108-44803115(AAAGACAG* -> A): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000296121.6_3 Variant: [VC Unknown @ chr3:44803108-44803115 Q1891.03 of type=INDEL alleles=[AAAGACAG*, A] attr={AC=2, AF=1.00, AN=2, DP=76, ExcessHet=0.0000, FS=0.000, MLEAC=2, MLEAF=1.00, MQ=62.79, QD=28.06, SOR=1.105} GT=GT:AD:DP:GQ:PL 1/1:0,44:44:99:1905,134,0 filters=

13:21:14.108 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000296121.6_3 for problem variant: chr3:44803108-44803115(AAAGACAG* -> A)

13:21:14.900 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2249, ref allele: G)

13:21:14.901 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2249, ref allele: G)

13:21:14.901 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2246, ref allele: G)

13:21:14.901 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2264, ref allele: G)

13:21:15.839 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000295899.10_3 for variant: chr3:63849473-63849482(CGCGGCGGCG* -> C): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000295899.10_3 Variant: [VC Unknown @ chr3:63849473-63849482 Q1743.60 of type=INDEL alleles=[CGCGGCGGCG*, C] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=-0.255, DP=327, ExcessHet=0.0000, FS=3.437, MLEAC=1, MLEAF=0.500, MQ=62.67, MQRankSum=14.463, QD=5.99, ReadPosRankSum=-2.761, SOR=0.904} GT=GT:AD:DP:GQ:PL 0/1:192,99:291:99:1751,0,7485 filters=

13:21:15.839 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000295899.10_3 for problem variant: chr3:63849473-63849482(CGCGGCGGCG* -> C)

13:21:16.540 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000473129.1_1 for variant: chr3:112719791-112719792(CA* -> C): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000473129.1_1 Variant: [VC Unknown @ chr3:112719791-112719792 Q334.60 of type=INDEL alleles=[CA*, C] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=0.304, DP=117, ExcessHet=0.0000, FS=2.325, MLEAC=1, MLEAF=0.500, MQ=60.83, MQRankSum=4.367, QD=4.65, ReadPosRankSum=-1.865, SOR=0.425} GT=GT:AD:DP:GQ:PL 0/1:46,26:72:99:342,0,842 filters=

13:21:16.540 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000473129.1_1 for problem variant: chr3:112719791-112719792(CA* -> C)

13:21:17.016 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000485866.5_2 for variant: chr3:124951171-124951172(CT* -> C): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000485866.5_2 Variant: [VC Unknown @ chr3:124951171-124951172 Q685.60 of type=INDEL alleles=[CT*, C] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=1.694, DP=92, ExcessHet=0.0000, FS=9.530, MLEAC=1, MLEAF=0.500, MQ=62.31, MQRankSum=4.991, QD=9.79, ReadPosRankSum=-2.247, SOR=0.817} GT=GT:AD:DP:GQ:PL 0/1:25,45:70:99:693,0,401 filters=

13:21:17.016 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000485866.5_2 for problem variant: chr3:124951171-124951172(CT* -> C)

13:21:17.448 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000337331.10_3 for variant: chr3:132441248-132441276(CGGAACGGAACGGGACGGGGTGGGGCAGA* -> C): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000337331.10_3 Variant: [VC Unknown @ chr3:132441248-132441276 Q325.60 of type=INDEL alleles=[CGGAACGGAACGGGACGGGGTGGGGCAGA*, C] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=1.542, DP=43, ExcessHet=0.0000, FS=0.000, MLEAC=1, MLEAF=0.500, MQ=60.00, MQRankSum=0.000, QD=16.28, ReadPosRankSum=-1.405, SOR=0.446} GT=GT:AD:DP:GQ:PL 0/1:7,13:20:99:333,0,170 filters=

13:21:17.450 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000337331.10_3 for problem variant: chr3:132441248-132441276(CGGAACGGAACGGGACGGGGTGGGGCAGA* -> C)

13:21:17.450 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000383282.3_4 for variant: chr3:132441248-132441276(CGGAACGGAACGGGACGGGGTGGGGCAGA* -> C): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000383282.3_4 Variant: [VC Unknown @ chr3:132441248-132441276 Q325.60 of type=INDEL alleles=[CGGAACGGAACGGGACGGGGTGGGGCAGA*, C] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=1.542, DP=43, ExcessHet=0.0000, FS=0.000, MLEAC=1, MLEAF=0.500, MQ=60.00, MQRankSum=0.000, QD=16.28, ReadPosRankSum=-1.405, SOR=0.446} GT=GT:AD:DP:GQ:PL 0/1:7,13:20:99:333,0,170 filters=

13:21:17.450 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000383282.3_4 for problem variant: chr3:132441248-132441276(CGGAACGGAACGGGACGGGGTGGGGCAGA* -> C)

13:21:17.490 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1828, ref allele: T)

13:21:17.491 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1837, ref allele: T)

13:21:17.491 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1828, ref allele: C)

13:21:17.491 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1837, ref allele: C)

13:21:17.590 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000477593.5_2 for variant: chr3:138372840-138372907(CCATAAAGAAGAGGCTCACCCATTCCAAGAGCAGCCGAAACCAGCTCACTCATTTATTTGACTGAGAA* -> C): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000477593.5_2 Variant: [VC Unknown @ chr3:138372840-138372907 Q34.60 of type=INDEL alleles=[CCATAAAGAAGAGGCTCACCCATTCCAAGAGCAGCCGAAACCAGCTCACTCATTTATTTGACTGAGAA*, C] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=0.000, DP=10, ExcessHet=0.0000, FS=0.000, MLEAC=1, MLEAF=0.500, MQ=60.00, MQRankSum=0.000, QD=3.46, ReadPosRankSum=-0.253, SOR=0.693} GT=GT:AD:DP:GQ:PL 0/1:8,2:10:42:42,0,228 filters=

13:21:17.590 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000477593.5_2 for problem variant: chr3:138372840-138372907(CCATAAAGAAGAGGCTCACCCATTCCAAGAGCAGCCGAAACCAGCTCACTCATTTATTTGACTGAGAA* -> C)

13:21:17.590 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000544716.5_2 for variant: chr3:138372840-138372907(CCATAAAGAAGAGGCTCACCCATTCCAAGAGCAGCCGAAACCAGCTCACTCATTTATTTGACTGAGAA* -> C): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000544716.5_2 Variant: [VC Unknown @ chr3:138372840-138372907 Q34.60 of type=INDEL alleles=[CCATAAAGAAGAGGCTCACCCATTCCAAGAGCAGCCGAAACCAGCTCACTCATTTATTTGACTGAGAA*, C] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=0.000, DP=10, ExcessHet=0.0000, FS=0.000, MLEAC=1, MLEAF=0.500, MQ=60.00, MQRankSum=0.000, QD=3.46, ReadPosRankSum=-0.253, SOR=0.693} GT=GT:AD:DP:GQ:PL 0/1:8,2:10:42:42,0,228 filters=

13:21:17.590 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000544716.5_2 for problem variant: chr3:138372840-138372907(CCATAAAGAAGAGGCTCACCCATTCCAAGAGCAGCCGAAACCAGCTCACTCATTTATTTGACTGAGAA* -> C)

13:21:19.497 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1384, ref allele: C)

13:21:19.498 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1837, ref allele: C)

13:21:19.498 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1933, ref allele: C)

13:21:19.499 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1384, ref allele: G)

13:21:19.499 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1837, ref allele: G)

13:21:19.499 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1933, ref allele: G)

13:21:19.500 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1384, ref allele: CA)

13:21:19.500 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1837, ref allele: CA)

13:21:19.500 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1933, ref allele: CA)

13:21:19.501 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1384, ref allele: G)

13:21:19.501 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1837, ref allele: G)

13:21:19.501 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1933, ref allele: G)

13:21:19.502 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1384, ref allele: G)

13:21:19.502 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1837, ref allele: G)

13:21:19.502 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1933, ref allele: G)

13:21:21.963 INFO ProgressMeter - chr4:147560457 0.5 2000 4210.2

13:21:23.672 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1414, ref allele: GCAGGCCGCCGCCGCC)

13:21:23.672 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1414, alt allele: C)

13:21:23.672 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1402, ref allele: C)

13:21:23.858 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=938, ref allele: C)

13:21:23.859 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1016, ref allele: C)

13:21:23.913 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000514280.1_1 for variant: chr5:79646839-79646840(CT* -> C): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000514280.1_1 Variant: [VC Unknown @ chr5:79646839-79646840 Q2618.03 of type=INDEL alleles=[CT*, C] attr={AC=2, AF=1.00, AN=2, DP=73, ExcessHet=0.0000, FS=0.000, MLEAC=2, MLEAF=1.00, MQ=54.58, QD=31.64, SOR=0.750} GT=GT:AD:DP:GQ:PL 1/1:0,70:70:99:2632,211,0 filters=

13:21:23.913 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000514280.1_1 for problem variant: chr5:79646839-79646840(CT* -> C)

13:21:24.168 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=3836, ref allele: C)

13:21:24.784 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1397, ref allele: T)

13:21:25.154 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2393, ref allele: C)

13:21:25.852 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=3836, ref allele: T)

13:21:25.852 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=3353, ref allele: T)

13:21:25.853 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=3761, ref allele: T)

13:21:26.212 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=718, ref allele: G)

13:21:26.213 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=700, ref allele: G)

13:21:26.213 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=703, ref allele: G)

13:21:27.234 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1439, ref allele: T)

13:21:27.234 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1436, ref allele: T)

13:21:27.234 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1439, ref allele: T)

13:21:27.284 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr6:29855580-29855586 due to alternate allele: *

13:21:27.285 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr6:29855580-29855586 due to alternate allele: *

13:21:29.244 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr6:36359696-36359698 due to alternate allele: *

13:21:30.429 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr6:87925824-87925848 due to alternate allele: *

13:21:30.664 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr6:108243120-108243125 due to alternate allele: *

13:21:30.689 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr6:109850200-109850201 due to alternate allele: *

13:21:32.066 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000610273.5_3 for variant: chr6:160221279-160221290(GCGTGGGCAGCA* -> G): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000610273.5_3 Variant: [VC Unknown @ chr6:160221279-160221290 Q2417.60 of type=INDEL alleles=[GCGTGGGCAGCA*, G] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=1.202, DP=158, ExcessHet=0.0000, FS=5.284, MLEAC=1, MLEAF=0.500, MQ=62.22, MQRankSum=7.001, QD=18.04, ReadPosRankSum=-1.287, SOR=1.154} GT=GT:AD:DP:GQ:PL 0/1:71,63:134:99:2425,0,2604 filters=

13:21:32.066 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000610273.5_3 for problem variant: chr6:160221279-160221290(GCGTGGGCAGCA* -> G)

13:21:32.467 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=440, ref allele: C)

13:21:32.754 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr7:8196567-8196585 due to alternate allele: *

13:21:32.755 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr7:8196567-8196585 due to alternate allele: *

13:21:32.785 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000403527.5_2 for variant: chr7:13933779-13933780(AT* -> A): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000403527.5_2 Variant: [VC Unknown @ chr7:13933779-13933780 Q110.60 of type=INDEL alleles=[AT*, A] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=0.000, DP=67, ExcessHet=0.0000, FS=1.737, MLEAC=1, MLEAF=0.500, MQ=60.64, MQRankSum=3.718, QD=2.70, ReadPosRankSum=-0.902, SOR=0.767} GT=GT:AD:DP:GQ:PL 0/1:28,13:41:99:118,0,524 filters=

13:21:32.785 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000403527.5_2 for problem variant: chr7:13933779-13933780(AT* -> A)

13:21:33.263 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2441, ref allele: C)

13:21:33.488 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=2071, ref allele: T)

13:21:33.488 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=2071, ref allele: C)

13:21:33.879 INFO ProgressMeter - chr7:50357896 0.7 3000 4453.5

13:21:34.400 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1961, ref allele: G)

13:21:35.621 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=8435, ref allele: TACA)

13:21:35.621 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=8435, alt allele: T)

13:21:35.621 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=8162, ref allele: TACA)

13:21:35.622 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=8162, alt allele: T)

13:21:35.622 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=8435, ref allele: TACA)

13:21:35.622 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=8435, alt allele: T)

13:21:35.622 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=8162, ref allele: TACA)

13:21:35.622 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=8162, alt allele: T)

13:21:36.059 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1325, ref allele: A)

13:21:36.059 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1319, ref allele: A)

13:21:36.935 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=4892, ref allele: A)

13:21:36.935 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=4712, ref allele: A)

13:21:36.936 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=4520, ref allele: A)

13:21:38.041 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=3194, ref allele: G)

13:21:38.042 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=3092, ref allele: G)

13:21:38.181 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2780, ref allele: C)

13:21:38.274 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2462, ref allele: A)

13:21:38.994 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=404, ref allele: GC)

13:21:38.994 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=974, ref allele: GC)

13:21:39.607 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=932, ref allele: G)

13:21:39.607 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=812, ref allele: G)

13:21:39.607 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=689, ref allele: G)

13:21:39.607 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=701, ref allele: G)

13:21:40.084 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=12392, ref allele: T)

13:21:40.085 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=12299, ref allele: T)

13:21:40.175 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr8:57389328-57389331 due to alternate allele: *

13:21:40.285 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1604, ref allele: A)

13:21:40.286 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1757, ref allele: A)

13:21:40.286 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1751, ref allele: A)

13:21:40.286 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1766, ref allele: A)

13:21:40.286 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1604, ref allele: A)

13:21:40.286 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1766, ref allele: A)

13:21:47.095 INFO ProgressMeter - chr10:32520879 0.9 4000 4474.8

13:21:48.306 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=4451, ref allele: T)

13:21:49.044 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1408, ref allele: C)

13:21:51.357 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2423, ref allele: G)

13:21:51.990 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000241001.13_4 for variant: chr11:31811460-31811461(CT* -> C): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000241001.13_4 Variant: [VC Unknown @ chr11:31811460-31811461 Q173.60 of type=INDEL alleles=[CT*, C] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=1.156, DP=168, ExcessHet=0.0000, FS=2.020, MLEAC=1, MLEAF=0.500, MQ=60.32, MQRankSum=0.000, QD=3.54, ReadPosRankSum=-0.953, SOR=0.252} GT=GT:AD:DP:GQ:PL 0/1:29,20:49:99:181,0,349 filters=

13:21:51.990 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000241001.13_4 for problem variant: chr11:31811460-31811461(CT* -> C)

13:21:55.440 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1799, ref allele: T)

13:21:55.441 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=692, ref allele: A)

13:21:55.442 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1294, ref allele: G)

13:21:55.443 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1294, ref allele: G)

13:21:56.771 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=695, ref allele: T)

13:21:56.793 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=848, ref allele: G)

13:21:56.959 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1417, ref allele: C)

13:21:57.258 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2051, ref allele: G)

13:21:57.258 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1418, ref allele: G)

13:21:57.334 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2285, ref allele: GC)

13:21:57.334 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2546, ref allele: GC)

13:21:57.335 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2576, ref allele: GC)

13:21:57.335 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2654, ref allele: GC)

13:21:57.335 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2177, ref allele: GC)

13:21:57.335 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2180, ref allele: GC)

13:21:57.335 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2576, ref allele: GC)

13:21:57.336 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2546, ref allele: GC)

13:21:57.336 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1094, ref allele: GC)

13:21:57.336 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2285, ref allele: GC)

13:21:57.784 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1756, ref allele: G)

13:21:57.785 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1663, ref allele: G)

13:21:57.854 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2825, ref allele: T)

13:21:57.854 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2795, ref allele: T)

13:21:58.299 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=503, ref allele: A)

13:21:58.299 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=980, ref allele: A)

13:21:58.299 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=503, ref allele: A)

13:21:58.299 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1022, ref allele: A)

13:21:58.299 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=788, ref allele: A)

13:21:59.074 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2210, ref allele: C)

13:21:59.147 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=733, ref allele: A)

13:22:02.801 INFO ProgressMeter - chr12:91372042 1.2 5000 4326.5

13:22:04.503 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr12:133353107-133353117 due to alternate allele: *

13:22:04.504 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr12:133353107-133353117 due to alternate allele: *

13:22:04.504 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr12:133353121-133353190 due to alternate allele: *

13:22:05.643 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr13:95715148-95715152 due to alternate allele: *

13:22:07.955 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=398, ref allele: T)

13:22:07.956 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=398, ref allele: T)

13:22:08.395 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1925, ref allele: G)

13:22:09.429 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000557714.1_1 for variant: chr14:102276205-102276206(CT* -> C): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000557714.1_1 Variant: [VC Unknown @ chr14:102276205-102276206 Q86.60 of type=INDEL alleles=[CT*, C] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=-0.991, DP=23, ExcessHet=0.0000, FS=0.000, MLEAC=1, MLEAF=0.500, MQ=60.93, MQRankSum=2.056, QD=3.77, ReadPosRankSum=0.240, SOR=0.527} GT=GT:AD:DP:GQ:PL 0/1:16,7:23:94:94,0,329 filters=

13:22:09.429 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000557714.1_1 for problem variant: chr14:102276205-102276206(CT* -> C)

13:22:10.064 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr15:23104664-23104685 due to alternate allele: *

13:22:10.065 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr15:23104664-23104685 due to alternate allele: *

13:22:10.065 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr15:23104680-23104686 due to alternate allele: *

13:22:13.336 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1019, ref allele: A)

13:22:13.336 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=3761, ref allele: A)

13:22:13.336 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=4697, ref allele: A)

13:22:13.428 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=2914, ref allele: C)

13:22:13.428 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=2875, ref allele: C)

13:22:13.428 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=2932, ref allele: C)

13:22:13.429 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=2893, ref allele: C)

13:22:13.429 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1963, ref allele: C)

13:22:13.429 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1876, ref allele: C)

13:22:13.429 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=1999, ref allele: C)

13:22:13.437 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1715, ref allele: T)

13:22:13.437 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1640, ref allele: T)

13:22:16.397 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=9806, ref allele: C)

13:22:16.596 INFO ProgressMeter - chr16:17252844 1.4 6000 4330.3

13:22:16.654 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000562711.6_1 for variant: chr16:19278429-19278430(TA* -> T): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000562711.6_1 Variant: [VC Unknown @ chr16:19278429-19278430 Q210.02 of type=INDEL alleles=[TA*, T, TAAAA] attr={AC=[1, 1], AF=[0.500, 0.500], AN=2, BaseQRankSum=-2.520, DP=30, ExcessHet=0.0000, FS=0.000, MLEAC=[1, 1], MLEAF=[0.500, 0.500], MQ=60.72, MQRankSum=0.751, QD=12.35, ReadPosRankSum=0.914, SOR=0.307} GT=GT:AD:DP:GQ:PL 1/2:4,8,5:17:98:227,108,163,98,0,274 filters=

13:22:16.654 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000562711.6_1 for problem variant: chr16:19278429-19278430(TA* -> T)

13:22:16.655 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000562711.6_1 for variant: chr16:19278429-19278430(TA* -> TAAAA): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000562711.6_1 Variant: [VC Unknown @ chr16:19278429-19278430 Q210.02 of type=INDEL alleles=[TA*, T, TAAAA] attr={AC=[1, 1], AF=[0.500, 0.500], AN=2, BaseQRankSum=-2.520, DP=30, ExcessHet=0.0000, FS=0.000, MLEAC=[1, 1], MLEAF=[0.500, 0.500], MQ=60.72, MQRankSum=0.751, QD=12.35, ReadPosRankSum=0.914, SOR=0.307} GT=GT:AD:DP:GQ:PL 1/2:4,8,5:17:98:227,108,163,98,0,274 filters=

13:22:16.655 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000562711.6_1 for problem variant: chr16:19278429-19278430(TA* -> TAAAA)

13:22:19.605 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr16:74566091-74566093 due to alternate allele: *

13:22:19.678 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=3782, ref allele: G)

13:22:19.678 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=3926, ref allele: G)

13:22:19.679 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=3782, ref allele: G)

13:22:19.679 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=3737, ref allele: G)

13:22:20.007 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr16:88593210-88593211 due to alternate allele: *

13:22:20.072 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr16:88948974-88948986 due to alternate allele: *

13:22:20.539 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr17:1690303-1690305 due to alternate allele: *

13:22:21.229 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=356, ref allele: C)

13:22:21.961 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2270, ref allele: T)

13:22:22.654 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000575023.5_1 for variant: chr17:19437178-19437200(GCGCGGTACTCACTGCCGGCCTC* -> G): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000575023.5_1 Variant: [VC Unknown @ chr17:19437178-19437200 Q172.60 of type=INDEL alleles=[GCGCGGTACTCACTGCCGGCCTC*, G] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=0.792, DP=15, ExcessHet=0.0000, FS=2.363, MLEAC=1, MLEAF=0.500, MQ=60.00, MQRankSum=0.000, QD=11.51, ReadPosRankSum=1.710, SOR=1.981} GT=GT:AD:DP:GQ:PL 0/1:10,5:15:99:180,0,363 filters=

13:22:22.654 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000575023.5_1 for problem variant: chr17:19437178-19437200(GCGCGGTACTCACTGCCGGCCTC* -> G)

13:22:22.654 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000395585.5_1 for variant: chr17:19437178-19437200(GCGCGGTACTCACTGCCGGCCTC* -> G): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000395585.5_1 Variant: [VC Unknown @ chr17:19437178-19437200 Q172.60 of type=INDEL alleles=[GCGCGGTACTCACTGCCGGCCTC*, G] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=0.792, DP=15, ExcessHet=0.0000, FS=2.363, MLEAC=1, MLEAF=0.500, MQ=60.00, MQRankSum=0.000, QD=11.51, ReadPosRankSum=1.710, SOR=1.981} GT=GT:AD:DP:GQ:PL 0/1:10,5:15:99:180,0,363 filters=

13:22:22.654 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000395585.5_1 for problem variant: chr17:19437178-19437200(GCGCGGTACTCACTGCCGGCCTC* -> G)

13:22:22.908 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=347, ref allele: C)

13:22:22.973 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1109, ref allele: C)

13:22:22.973 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1055, ref allele: C)

13:22:22.974 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2162, ref allele: C)

13:22:22.975 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2162, ref allele: G)

13:22:22.976 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2162, ref allele: A)

13:22:22.976 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2162, ref allele: GGT)

13:22:23.387 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000333942.10_2 for variant: chr17:30469470-30469485(CCCGCCGCCGCCGCCG* -> C): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000333942.10_2 Variant: [VC Unknown @ chr17:30469470-30469485 Q1614.02 of type=INDEL alleles=[CCCGCCGCCGCCGCCG*, C, CCCGCCG] attr={AC=[1, 1], AF=[0.500, 0.500], AN=2, DP=69, ExcessHet=0.0000, FS=0.000, MLEAC=[1, 1], MLEAF=[0.500, 0.500], MQ=62.68, QD=29.50, SOR=0.850} GT=GT:AD:DP:GQ:PL 1/2:0,10,29:39:99:1631,1224,1832,369,0,277 filters=

13:22:23.388 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000333942.10_2 for problem variant: chr17:30469470-30469485(CCCGCCGCCGCCGCCG* -> C)

13:22:23.388 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000358365.7_2 for variant: chr17:30469470-30469485(CCCGCCGCCGCCGCCG* -> C): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000358365.7_2 Variant: [VC Unknown @ chr17:30469470-30469485 Q1614.02 of type=INDEL alleles=[CCCGCCGCCGCCGCCG*, C, CCCGCCG] attr={AC=[1, 1], AF=[0.500, 0.500], AN=2, DP=69, ExcessHet=0.0000, FS=0.000, MLEAC=[1, 1], MLEAF=[0.500, 0.500], MQ=62.68, QD=29.50, SOR=0.850} GT=GT:AD:DP:GQ:PL 1/2:0,10,29:39:99:1631,1224,1832,369,0,277 filters=

13:22:23.388 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000358365.7_2 for problem variant: chr17:30469470-30469485(CCCGCCGCCGCCGCCG* -> C)

13:22:23.388 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000333942.10_2 for variant: chr17:30469470-30469485(CCCGCCGCCGCCGCCG* -> CCCGCCG): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000333942.10_2 Variant: [VC Unknown @ chr17:30469470-30469485 Q1614.02 of type=INDEL alleles=[CCCGCCGCCGCCGCCG*, C, CCCGCCG] attr={AC=[1, 1], AF=[0.500, 0.500], AN=2, DP=69, ExcessHet=0.0000, FS=0.000, MLEAC=[1, 1], MLEAF=[0.500, 0.500], MQ=62.68, QD=29.50, SOR=0.850} GT=GT:AD:DP:GQ:PL 1/2:0,10,29:39:99:1631,1224,1832,369,0,277 filters=

13:22:23.388 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000333942.10_2 for problem variant: chr17:30469470-30469485(CCCGCCGCCGCCGCCG* -> CCCGCCG)

13:22:23.388 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000358365.7_2 for variant: chr17:30469470-30469485(CCCGCCGCCGCCGCCG* -> CCCGCCG): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000358365.7_2 Variant: [VC Unknown @ chr17:30469470-30469485 Q1614.02 of type=INDEL alleles=[CCCGCCGCCGCCGCCG*, C, CCCGCCG] attr={AC=[1, 1], AF=[0.500, 0.500], AN=2, DP=69, ExcessHet=0.0000, FS=0.000, MLEAC=[1, 1], MLEAF=[0.500, 0.500], MQ=62.68, QD=29.50, SOR=0.850} GT=GT:AD:DP:GQ:PL 1/2:0,10,29:39:99:1631,1224,1832,369,0,277 filters=

13:22:23.388 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000358365.7_2 for problem variant: chr17:30469470-30469485(CCCGCCGCCGCCGCCG* -> CCCGCCG)

13:22:23.502 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1568, ref allele: C)

13:22:23.503 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1187, ref allele: C)

13:22:23.880 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1988, ref allele: A)

13:22:25.046 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2375, ref allele: A)

13:22:25.092 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2849, ref allele: G)

13:22:25.464 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=635, ref allele: G)

13:22:25.464 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=635, ref allele: A)

13:22:25.464 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=635, ref allele: T)

13:22:25.701 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2456, ref allele: C)

13:22:25.702 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2456, ref allele: C)

13:22:27.029 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=9194, ref allele: C)

13:22:27.030 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=9194, ref allele: TGGCTGCGGCGGCGGCTGC)

13:22:27.030 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=9194, alt allele: T)

13:22:27.031 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=9194, ref allele: CAAGGGGCGGGGCCGCGGGAAAGCGGAT)

13:22:27.031 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=9194, alt allele: C)

13:22:27.031 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=9194, ref allele: CTG)

13:22:27.032 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=4592, ref allele: CTG)

13:22:27.033 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=9194, ref allele: CAGG)

13:22:27.033 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=9194, alt allele: C)

13:22:27.033 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=4592, ref allele: CAGG)

13:22:27.033 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=4592, alt allele: C)

13:22:27.033 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=4802, ref allele: CAGG)

13:22:27.033 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=4802, alt allele: C)

13:22:27.034 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=9194, ref allele: A)

13:22:27.034 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=4592, ref allele: A)

13:22:27.034 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=4802, ref allele: A)

13:22:29.175 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000580060.1_1 for variant: chr18:47023266-47023267(TC* -> T): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000580060.1_1 Variant: [VC Unknown @ chr18:47023266-47023267 Q101.60 of type=INDEL alleles=[TC*, T] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=0.072, DP=33, ExcessHet=0.0000, FS=0.000, MLEAC=1, MLEAF=0.500, MQ=60.65, MQRankSum=2.961, QD=4.06, ReadPosRankSum=1.736, SOR=1.022} GT=GT:AD:DP:GQ:PL 0/1:20,5:25:99:109,0,682 filters=

13:22:29.175 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000580060.1_1 for problem variant: chr18:47023266-47023267(TC* -> T)

13:22:30.205 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=875, ref allele: G)

13:22:30.206 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1778, ref allele: G)

13:22:30.206 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1535, ref allele: G)

13:22:30.206 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=959, ref allele: G)

13:22:30.406 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2381, ref allele: G)

13:22:30.406 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2573, ref allele: G)

13:22:30.407 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2381, ref allele: G)

13:22:30.407 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2420, ref allele: G)

13:22:30.407 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2381, ref allele: G)

13:22:30.659 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=4046, ref allele: T)

13:22:31.562 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1562, ref allele: G)

13:22:32.086 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000587562.1_1 for variant: chr19:20317763-20317770(GTTCCTGA* -> G): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000587562.1_1 Variant: [VC Unknown @ chr19:20317763-20317770 Q112.60 of type=INDEL alleles=[GTTCCTGA*, G] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=0.000, DP=20, ExcessHet=0.0000, FS=0.000, MLEAC=1, MLEAF=0.500, MQ=61.07, MQRankSum=2.997, QD=5.63, ReadPosRankSum=0.250, SOR=0.693} GT=GT:AD:DP:GQ:PL 0/1:16,4:20:99:120,0,660 filters=

13:22:32.086 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000587562.1_1 for problem variant: chr19:20317763-20317770(GTTCCTGA* -> G)

13:22:32.411 INFO ProgressMeter - chr19:36258937 1.6 7000 4244.6

13:22:32.822 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=4763, ref allele: A)

13:22:32.822 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=4874, ref allele: A)

13:22:32.822 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=4673, ref allele: A)

13:22:34.274 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1445, ref allele: AGCCATGGGGCGAGATGAAGGAGCC)

13:22:34.275 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1445, alt allele: C)

13:22:34.311 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1085, ref allele: T)

13:22:34.483 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1646, ref allele: A)

13:22:34.483 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1961, ref allele: A)

13:22:34.484 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1865, ref allele: A)

13:22:34.484 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1835, ref allele: A)

13:22:34.484 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1961, ref allele: A)

13:22:34.485 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000596929.5_2 for variant: chr19:58788582-58788630(GGGCCAGAAGGATCTGAGAGAGTGTGGCCAGCTTGAGCCCTCAGGAGTC* -> G): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000596929.5_2 Variant: [VC Unknown @ chr19:58788582-58788630 Q294.60 of type=INDEL alleles=[GGGCCAGAAGGATCTGAGAGAGTGTGGCCAGCTTGAGCCCTCAGGAGTC*, G] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=4.090, DP=266, ExcessHet=0.0000, FS=1.916, MLEAC=1, MLEAF=0.500, MQ=61.40, MQRankSum=-6.599, QD=2.95, ReadPosRankSum=1.394, SOR=0.932} GT=GT:AD:DP:GQ:PL 0/1:77,23:100:99:302,0,2609 filters=

13:22:34.485 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000596929.5_2 for problem variant: chr19:58788582-58788630(GGGCCAGAAGGATCTGAGAGAGTGTGGCCAGCTTGAGCCCTCAGGAGTC* -> G)

13:22:34.485 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000595981.5_1 for variant: chr19:58788582-58788630(GGGCCAGAAGGATCTGAGAGAGTGTGGCCAGCTTGAGCCCTCAGGAGTC* -> G): Reference allele runs off end of coding sequence. Cannot yet handle this case.

13:22:34.485 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000595981.5_1 for problem variant: chr19:58788582-58788630(GGGCCAGAAGGATCTGAGAGAGTGTGGCCAGCTTGAGCCCTCAGGAGTC* -> G)

13:22:35.083 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1874, ref allele: C)

13:22:35.084 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1874, ref allele: A)

13:22:35.084 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1712, ref allele: A)

13:22:35.084 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1622, ref allele: A)

13:22:35.084 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2021, ref allele: A)

13:22:35.435 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000344201.7_1 for variant: chr20:32211760-32211761(GA* -> G): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000344201.7_1 Variant: [VC Unknown @ chr20:32211760-32211761 Q86.60 of type=INDEL alleles=[GA*, G] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=1.370, DP=46, ExcessHet=0.0000, FS=8.649, MLEAC=1, MLEAF=0.500, MQ=60.00, MQRankSum=0.000, QD=3.94, ReadPosRankSum=-0.185, SOR=1.074} GT=GT:AD:DP:GQ:PL 0/1:16,6:22:94:94,0,316 filters=

13:22:35.435 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000344201.7_1 for problem variant: chr20:32211760-32211761(GA* -> G)

13:22:38.229 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr21:46057625-46057640 due to alternate allele: *

13:22:38.673 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=4757, ref allele: T)

13:22:38.673 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=4928, ref allele: T)

13:22:38.673 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1115, ref allele: T)

13:22:38.674 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1397, ref allele: T)

13:22:38.785 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2591, ref allele: G)

13:22:38.785 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2606, ref allele: G)

13:22:38.786 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2591, ref allele: C)

13:22:38.786 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2606, ref allele: C)

13:22:38.866 WARN GencodeFuncotationFactory - Cannot create complete funcotation for variant at chr22:21846328-21846329 due to alternate allele: *

13:22:39.191 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2045, ref allele: G)

13:22:39.192 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2045, ref allele: G)

13:22:40.299 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=1148, ref allele: A)

13:22:40.424 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=2474, ref allele: C)

13:22:41.303 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=3821, ref allele: T)

13:22:41.884 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000536164.5_1 for variant: chrX:105139356-105139360(CAGAA* -> C): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000536164.5_1 Variant: [VC Unknown @ chrX:105139356-105139360 Q37.60 of type=INDEL alleles=[CAGAA*, C] attr={AC=1, AF=0.500, AN=2, BaseQRankSum=-0.549, DP=26, ExcessHet=0.0000, FS=0.000, MLEAC=1, MLEAF=0.500, MQ=60.83, MQRankSum=3.886, QD=2.51, ReadPosRankSum=-0.812, SOR=0.569} GT=GT:AD:DP:GQ:PL 0/1:13,2:15:45:45,0,483 filters=

13:22:41.884 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000536164.5_1 for problem variant: chrX:105139356-105139360(CAGAA* -> C)

13:22:42.164 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 2 (size=434, ref allele: T)

13:22:42.404 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000448905.6_2 for variant: chrX:150151871-150151883(CCCGCCGCCGCCG* -> C): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000448905.6_2 Variant: [VC Unknown @ chrX:150151871-150151883 Q934.02 of type=INDEL alleles=[CCCGCCGCCGCCG*, C, CCCG] attr={AC=[1, 1], AF=[0.500, 0.500], AN=2, BaseQRankSum=0.408, DP=40, ExcessHet=0.0000, FS=0.000, MLEAC=[1, 1], MLEAF=[0.500, 0.500], MQ=62.17, MQRankSum=1.648, QD=32.21, ReadPosRankSum=-0.216, SOR=0.765} GT=GT:AD:DP:GQ:PL 1/2:2,5,22:29:80:951,742,897,108,0,80 filters=

13:22:42.404 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000448905.6_2 for problem variant: chrX:150151871-150151883(CCCGCCGCCGCCG* -> C)

13:22:42.404 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000448905.6_2 for variant: chrX:150151871-150151883(CCCGCCGCCGCCG* -> CCCG): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000448905.6_2 Variant: [VC Unknown @ chrX:150151871-150151883 Q934.02 of type=INDEL alleles=[CCCGCCGCCGCCG*, C, CCCG] attr={AC=[1, 1], AF=[0.500, 0.500], AN=2, BaseQRankSum=0.408, DP=40, ExcessHet=0.0000, FS=0.000, MLEAC=[1, 1], MLEAF=[0.500, 0.500], MQ=62.17, MQRankSum=1.648, QD=32.21, ReadPosRankSum=-0.216, SOR=0.765} GT=GT:AD:DP:GQ:PL 1/2:2,5,22:29:80:951,742,897,108,0,80 filters=

13:22:42.404 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000448905.6_2 for problem variant: chrX:150151871-150151883(CCCGCCGCCGCCG* -> CCCG)

13:22:42.499 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=751, ref allele: C)

13:22:42.499 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=691, ref allele: C)

13:22:42.500 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=751, ref allele: C)

13:22:42.500 WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3. Dropping bases from the end: 1 (size=691, ref allele: C)

13:22:43.202 ERROR GencodeFuncotationFactory - Problem creating a GencodeFuncotation on transcript ENST00000557360.1_1 for variant: chrY:13471858-13471866(AATTTAGGT* -> A): Variant overlaps transcript but is not completely contained within it. Funcotator cannot currently handle this case. Transcript: ENST00000557360.1_1 Variant: [VC Unknown @ chrY:13471858-13471866 Q526.02 of type=INDEL alleles=[AATTTAGGT*, A] attr={AC=2, AF=1.00, AN=2, DP=14, ExcessHet=0.0000, FS=0.000, MLEAC=2, MLEAF=1.00, MQ=47.80, QD=31.03, SOR=0.693} GT=GT:AD:DP:GQ:PL 1/1:0,12:12:36:540,36,0 filters=

13:22:43.202 WARN GencodeFuncotationFactory - Creating default GencodeFuncotation on transcript ENST00000557360.1_1 for problem variant: chrY:13471858-13471866(AATTTAGGT* -> A)

13:22:43.335 INFO ProgressMeter - chr19:36258937 1.8 7939 4335.3

13:22:43.335 INFO ProgressMeter - Traversal complete. Processed 7939 total variants in 1.8 minutes.

13:22:43.335 INFO VcfFuncotationFactory - ClinVar_VCF 20180401 cache hits/total: 1/579

13:22:43.335 INFO VcfFuncotationFactory - LMMKnown 20180612 cache hits/total: 0/1

13:22:43.478 INFO Funcotator - Shutting down engine

[June 17, 2024, 1:22:43?PM EDT] org.broadinstitute.hellbender.tools.funcotator.Funcotator done. Elapsed time: 1.92 minutes.

Runtime.totalMemory()=1843396608

Tool returned:

true

Genome Analysis Toolkit

Need Help?

Community Forum

Funcotator "Problem creating a GencodeFuncotation on transcript. Variant overlaps transcript but is not completely contained within it." & "WARN FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3."

2 comments

Welcome

Didn't find what you were looking for?

Quick Links

Recent GATK News

About the GATK community