Annotate with local reference bases (REF_BASES)
Category Variant Annotations
Overview
Local reference context at a variant position. The annotation gives ten reference bases each to the left and right of the variant start and the start base for a total of 21 reference bases. Start position is defined as one base before indels. For example, the reference context AAAAAAAAAACTTTTTTTTTT would apply to a SNV variant context with ref allele C and alt allele G as well as to a deletion variant context with ref allele CT and alt allele C.GATK version 4.2.5.0-SNAPSHOT built at Mon, 7 Feb 2022 11:18:01 -0500.
0 comments
Please sign in to leave a comment.