Clip reads in a SAM/BAM/CRAM file

Category Read Data Manipulation

---

Overview

Read clipping based on quality, position or sequence matching. This tool provides simple, powerful read clipping capabilities that allow you to remove low quality strings of bases, sections of reads, and reads containing user-provided sequences.

There are three arguments for clipping (quality, position and sequence), which can be used alone or in combination. In addition, you can also specify a clipping representation, which determines exactly how ClipReads applies clips to the reads (soft clips, writing Q0 base quality scores, etc.). Please note that you MUST specify at least one of the three clipping arguments, and specifying a clipping representation is not sufficient. If you do not specify a clipping argument, the program will run but it will not do anything to your reads.

Quality score based clipping

Clip bases from the read in clipper from

argmax_x{ \sum{i = x + 1}^l (qTrimmingThreshold - qual)

to the end of the read. This is copied from BWA.

Walk through the read from the end (in machine cycle order) to the beginning, calculating the running sum of qTrimmingThreshold - qual. While we do this, we track the maximum value of this sum where the delta > 0. After the loop, clipPoint is either -1 (don't do anything) or the clipping index in the read (from the end).

Cycle based clipping

Clips machine cycles from the read. Accepts a string of ranges of the form start1-end1,start2-end2, etc. For each start/end pair, removes bases in machine cycles from start to end, inclusive. These are 1-based values (positions). For example, 1-5,10-12 clips the first 5 bases, and then three bases at cycles 10, 11, and 12.

Sequence matching

Clips bases that exactly match one of a number of base sequences. This employs an exact match algorithm, filtering only bases whose sequence exactly matches SEQ.

Input

Any number of SAM/BAM/CRAM files.

Output

A new SAM/BAM/CRAM file containing all of the reads from the input SAM/BAM/CRAMs with the user-specified clipping operation applied to each read.

Summary output (console)

 Number of examined reads              13
 Number of clipped reads               13
 Percent of clipped reads              100.00
 Number of examined bases              988
 Number of clipped bases               126
 Percent of clipped bases              12.75
 Number of quality-score clipped bases 126
 Number of range clipped bases         0
 Number of sequence clipped bases      0
 

Example usage

gatk ClipReads \
   -I input_reads.bam \
   -O output_reads.bam \
   -XF sequences.fasta \
   -X CCCCC \
   -CT "1-5,11-15" \
   -QT 10

The command line shown above will apply all three arguments in combination. See the detailed examples below to see how the choice of clipping representation affects the output.

Detailed clipping examples

Suppose we are given this read:

     314KGAAXX090507:1:19:1420:1123#0        16      chrM    3116    29      76M     *       *       *
          TAGGACCCGGGCCCCCCTCCCCAATCCTCCAACGCATATAGCGGCCGCGCCTTCCCCCGTAAATGATATCATCTCA
          #################4?6/?2135;;;'1/=/<'B9;12;68?A79@,@==@9?=AAA3;A@B;A?B54;?ABA
     

If we are clipping reads with -QT 10 and -CR WRITE_NS, we get:

     314KGAAXX090507:1:19:1420:1123#0        16      chrM    3116    29      76M     *       *       *
          NNNNNNNNNNNNNNNNNTCCCCAATCCTCCAACGCATATAGCGGCCGCGCCTTCCCCCGTAAATGATATCATCTCA
          #################4?6/?2135;;;'1/=/<'B9;12;68?A79@,@==@9?=AAA3;A@B;A?B54;?ABA
     

Whereas with -QT 10 -CR WRITE_Q0S:

     314KGAAXX090507:1:19:1420:1123#0        16      chrM    3116    29      76M     *       *       *
          TAGGACCCGGGCCCCCCTCCCCAATCCTCCAACGCATATAGCGGCCGCGCCTTCCCCCGTAAATGATATCATCTCA
          !!!!!!!!!!!!!!!!!4?6/?2135;;;'1/=/<'B9;12;68?A79@,@==@9?=AAA3;A@B;A?B54;?ABA
     

Or -QT 10 -CR SOFTCLIP_BASES:

     314KGAAXX090507:1:19:1420:1123#0        16      chrM    3133    29      17S59M  *       *       *
          TAGGACCCGGGCCCCCCTCCCCAATCCTCCAACGCATATAGCGGCCGCGCCTTCCCCCGTAAATGATATCATCTCA
          #################4?6/?2135;;;'1/=/<'B9;12;68?A79@,@==@9?=AAA3;A@B;A?B54;?ABA
     

---

Additional Information

Read filters

This Read Filter is automatically applied to the data by the Engine before processing by ClipReads.

• WellformedReadFilter

ClipReads specific arguments

This table summarizes the command-line arguments that are specific to this tool. For more details on each argument, see the list further down below the table or click on an argument name to jump directly to that entry in the list.

Argument name(s)	Default value	Summary
Required Arguments
--input  -I	[]	BAM/SAM/CRAM file containing reads
--output  -O	null	BAM output file
Optional Tool Arguments
--arguments_file	[]	read one or more arguments files and add them to the command line
--clip-representation  -CR	WRITE_NS	How should we actually clip the bases?
--clip-sequence  -X	[]	Remove sequences within reads matching this sequence
--clip-sequences-file  -XF	null	Remove sequences within reads matching the sequences in this FASTA file
--cloud-index-prefetch-buffer  -CIPB	-1	Size of the cloud-only prefetch buffer (in MB; 0 to disable). Defaults to cloudPrefetchBuffer if unset.
--cloud-prefetch-buffer  -CPB	40	Size of the cloud-only prefetch buffer (in MB; 0 to disable).
--cycles-to-trim  -CT	null	String indicating machine cycles to clip from the reads
--disable-bam-index-caching  -DBIC	false	If true, don't cache bam indexes, this will reduce memory requirements but may harm performance if many intervals are specified. Caching is automatically disabled if there are no intervals specified.
--disable-sequence-dictionary-validation	false	If specified, do not check the sequence dictionaries from our inputs for compatibility. Use at your own risk!
--gcs-max-retries  -gcs-retries	20	If the GCS bucket channel errors out, how many times it will attempt to re-initiate the connection
--gcs-project-for-requester-pays	""	Project to bill when accessing "requester pays" buckets. If unset, these buckets cannot be accessed.
--help  -h	false	display the help message
--interval-merging-rule  -imr	ALL	Interval merging rule for abutting intervals
--intervals  -L	[]	One or more genomic intervals over which to operate
--output-statistics  -os	null	File to output statistics
--q-trimming-threshold  -QT	-1	If provided, the Q-score clipper will be applied
--read	null
--reference  -R	null	Reference sequence
--sites-only-vcf-output	false	If true, don't emit genotype fields when writing vcf file output.
--version	false	display the version number for this tool
Optional Common Arguments
--add-output-sam-program-record	true	If true, adds a PG tag to created SAM/BAM/CRAM files.
--add-output-vcf-command-line	true	If true, adds a command line header line to created VCF files.
--create-output-bam-index  -OBI	true	If true, create a BAM/CRAM index when writing a coordinate-sorted BAM/CRAM file.
--create-output-bam-md5  -OBM	false	If true, create a MD5 digest for any BAM/SAM/CRAM file created
--create-output-variant-index  -OVI	true	If true, create a VCF index when writing a coordinate-sorted VCF file.
--create-output-variant-md5  -OVM	false	If true, create a a MD5 digest any VCF file created.
--disable-read-filter  -DF	[]	Read filters to be disabled before analysis
--disable-tool-default-read-filters	false	Disable all tool default read filters (WARNING: many tools will not function correctly without their default read filters on)
--exclude-intervals  -XL	[]	One or more genomic intervals to exclude from processing
--gatk-config-file	null	A configuration file to use with the GATK.
--interval-exclusion-padding  -ixp	0	Amount of padding (in bp) to add to each interval you are excluding.
--interval-padding  -ip	0	Amount of padding (in bp) to add to each interval you are including.
--interval-set-rule  -isr	UNION	Set merging approach to use for combining interval inputs
--lenient  -LE	false	Lenient processing of VCF files
--QUIET	false	Whether to suppress job-summary info on System.err.
--read-filter  -RF	[]	Read filters to be applied before analysis
--read-index	[]	Indices to use for the read inputs. If specified, an index must be provided for every read input and in the same order as the read inputs. If this argument is not specified, the path to the index for each input will be inferred automatically.
--read-validation-stringency  -VS	SILENT	Validation stringency for all SAM/BAM/CRAM/SRA files read by this program. The default stringency value SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded.
--seconds-between-progress-updates	10.0	Output traversal statistics every time this many seconds elapse
--sequence-dictionary	null	Use the given sequence dictionary as the master/canonical sequence dictionary. Must be a .dict file.
--tmp-dir	null	Temp directory to use.
--use-jdk-deflater  -jdk-deflater	false	Whether to use the JdkDeflater (as opposed to IntelDeflater)
--use-jdk-inflater  -jdk-inflater	false	Whether to use the JdkInflater (as opposed to IntelInflater)
--verbosity	INFO	Control verbosity of logging.
Advanced Arguments
--showHidden	false	display hidden arguments

Argument details

Arguments in this list are specific to this tool. Keep in mind that other arguments are available that are shared with other tools (e.g. command-line GATK arguments); see Inherited arguments above.

---

--add-output-sam-program-record / -add-output-sam-program-record

If true, adds a PG tag to created SAM/BAM/CRAM files.

boolean  true

---

--add-output-vcf-command-line / -add-output-vcf-command-line

If true, adds a command line header line to created VCF files.

boolean  true

---

--arguments_file / NA

read one or more arguments files and add them to the command line

List[File]  []

---

--clip-representation / -CR

How should we actually clip the bases?
The different values for this argument determines how ClipReads applies clips to the reads. This can range from writing Ns over the clipped bases to hard clipping away the bases from the BAM.

The --clip-representation argument is an enumerated type (ClippingRepresentation), which can have one of the following values:

WRITE_NS

Clipped bases are changed to Ns

WRITE_Q0S

Clipped bases are changed to have Q0 quality score

WRITE_NS_Q0S

Clipped bases are change to have both an N base and a Q0 quality score

SOFTCLIP_BASES

Change the read's cigar string to soft clip (S, see sam-spec) away the bases. Note that this can only be applied to cases where the clipped bases occur at the start or end of a read.

HARDCLIP_BASES

WARNING: THIS OPTION IS STILL UNDER DEVELOPMENT AND IS NOT SUPPORTED. Change the read's cigar string to hard clip (H, see sam-spec) away the bases. Hard clipping, unlike soft clipping, actually removes bases from the read, reducing the resulting file's size but introducing an irrevesible (i.e., lossy) operation. Note that this can only be applied to cases where the clipped bases occur at the start or end of a read.

REVERT_SOFTCLIPPED_BASES

Turn all soft-clipped bases into matches

ClippingRepresentation  WRITE_NS

---

--clip-sequence / -X

Remove sequences within reads matching this sequence
Clips bases from the reads matching the provided SEQ.

List[String]  []

---

--clip-sequences-file / -XF

Remove sequences within reads matching the sequences in this FASTA file
Reads the sequences in the provided FASTA file, and clip any bases that exactly match any of the sequences in the file.

String  null

---

--cloud-index-prefetch-buffer / -CIPB

Size of the cloud-only prefetch buffer (in MB; 0 to disable). Defaults to cloudPrefetchBuffer if unset.

int  -1  [ [ -∞  ∞ ] ]

---

--cloud-prefetch-buffer / -CPB

Size of the cloud-only prefetch buffer (in MB; 0 to disable).

int  40  [ [ -∞  ∞ ] ]

---

--create-output-bam-index / -OBI

If true, create a BAM/CRAM index when writing a coordinate-sorted BAM/CRAM file.

boolean  true

---

--create-output-bam-md5 / -OBM

If true, create a MD5 digest for any BAM/SAM/CRAM file created

boolean  false

---

--create-output-variant-index / -OVI

If true, create a VCF index when writing a coordinate-sorted VCF file.

boolean  true

---

--create-output-variant-md5 / -OVM

If true, create a a MD5 digest any VCF file created.

boolean  false

---

--cycles-to-trim / -CT

String indicating machine cycles to clip from the reads
Clips machine cycles from the read. Accepts a string of ranges of the form start1-end1,start2-end2, etc. For each start/end pair, removes bases in machine cycles from start to end, inclusive. These are 1-based values (positions). For example, 1-5,10-12 clips the first 5 bases, and then three bases at cycles 10, 11, and 12.

String  null

---

--disable-bam-index-caching / -DBIC

If true, don't cache bam indexes, this will reduce memory requirements but may harm performance if many intervals are specified. Caching is automatically disabled if there are no intervals specified.

boolean  false

---

--disable-read-filter / -DF

Read filters to be disabled before analysis

List[String]  []

---

--disable-sequence-dictionary-validation / -disable-sequence-dictionary-validation

If specified, do not check the sequence dictionaries from our inputs for compatibility. Use at your own risk!

boolean  false

---

--disable-tool-default-read-filters / -disable-tool-default-read-filters

Disable all tool default read filters (WARNING: many tools will not function correctly without their default read filters on)

boolean  false

---

--exclude-intervals / -XL

One or more genomic intervals to exclude from processing
Use this argument to exclude certain parts of the genome from the analysis (like -L, but the opposite). This argument can be specified multiple times. You can use samtools-style intervals either explicitly on the command line (e.g. -XL 1 or -XL 1:100-200) or by loading in a file containing a list of intervals (e.g. -XL myFile.intervals).

List[String]  []

---

--gatk-config-file / NA

A configuration file to use with the GATK.

String  null

---

--gcs-max-retries / -gcs-retries

If the GCS bucket channel errors out, how many times it will attempt to re-initiate the connection

int  20  [ [ -∞  ∞ ] ]

---

--gcs-project-for-requester-pays / NA

Project to bill when accessing "requester pays" buckets. If unset, these buckets cannot be accessed.

String  ""

---

--help / -h

display the help message

boolean  false

---

--input / -I

BAM/SAM/CRAM file containing reads

R List[String]  []

---

--interval-exclusion-padding / -ixp

Amount of padding (in bp) to add to each interval you are excluding.
Use this to add padding to the intervals specified using -XL. For example, '-XL 1:100' with a padding value of 20 would turn into '-XL 1:80-120'. This is typically used to add padding around targets when analyzing exomes.

int  0  [ [ -∞  ∞ ] ]

---

--interval-merging-rule / -imr

Interval merging rule for abutting intervals
By default, the program merges abutting intervals (i.e. intervals that are directly side-by-side but do not actually overlap) into a single continuous interval. However you can change this behavior if you want them to be treated as separate intervals instead.

The --interval-merging-rule argument is an enumerated type (IntervalMergingRule), which can have one of the following values:

ALL

OVERLAPPING_ONLY

IntervalMergingRule  ALL

---

--interval-padding / -ip

Amount of padding (in bp) to add to each interval you are including.
Use this to add padding to the intervals specified using -L. For example, '-L 1:100' with a padding value of 20 would turn into '-L 1:80-120'. This is typically used to add padding around targets when analyzing exomes.

int  0  [ [ -∞  ∞ ] ]

---

--interval-set-rule / -isr

Set merging approach to use for combining interval inputs
By default, the program will take the UNION of all intervals specified using -L and/or -XL. However, you can change this setting for -L, for example if you want to take the INTERSECTION of the sets instead. E.g. to perform the analysis only on chromosome 1 exomes, you could specify -L exomes.intervals -L 1 --interval-set-rule INTERSECTION. However, it is not possible to modify the merging approach for intervals passed using -XL (they will always be merged using UNION). Note that if you specify both -L and -XL, the -XL interval set will be subtracted from the -L interval set.

The --interval-set-rule argument is an enumerated type (IntervalSetRule), which can have one of the following values:

UNION

Take the union of all intervals

INTERSECTION

Take the intersection of intervals (the subset that overlaps all intervals specified)

IntervalSetRule  UNION

---

--intervals / -L

One or more genomic intervals over which to operate

List[String]  []

---

--lenient / -LE

Lenient processing of VCF files

boolean  false

---

--output / -O

BAM output file
The output SAM/BAM/CRAM file will be written here

R String  null

---

--output-statistics / -os

File to output statistics
If provided, ClipReads will write summary statistics about the clipping operations applied to the reads in this file.

File  null

---

--q-trimming-threshold / -QT

If provided, the Q-score clipper will be applied
If a value > 0 is provided, then the quality score based read clipper will be applied to the reads using this quality score threshold.

int  -1  [ [ -∞  ∞ ] ]

---

--QUIET / NA

Whether to suppress job-summary info on System.err.

Boolean  false

---

--read / -read

String  null

---

--read-filter / -RF

Read filters to be applied before analysis

List[String]  []

---

--read-index / -read-index

Indices to use for the read inputs. If specified, an index must be provided for every read input and in the same order as the read inputs. If this argument is not specified, the path to the index for each input will be inferred automatically.

List[String]  []

---

--read-validation-stringency / -VS

Validation stringency for all SAM/BAM/CRAM/SRA files read by this program. The default stringency value SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded.

The --read-validation-stringency argument is an enumerated type (ValidationStringency), which can have one of the following values:

STRICT

LENIENT

SILENT

ValidationStringency  SILENT

---

--reference / -R

Reference sequence

String  null

---

--seconds-between-progress-updates / -seconds-between-progress-updates

Output traversal statistics every time this many seconds elapse

double  10.0  [ [ -∞  ∞ ] ]

---

--sequence-dictionary / -sequence-dictionary

Use the given sequence dictionary as the master/canonical sequence dictionary. Must be a .dict file.

String  null

---

--showHidden / -showHidden

display hidden arguments

boolean  false

---

--sites-only-vcf-output / NA

If true, don't emit genotype fields when writing vcf file output.

boolean  false

---

--tmp-dir / NA

Temp directory to use.

GATKPathSpecifier  null

---

--use-jdk-deflater / -jdk-deflater

Whether to use the JdkDeflater (as opposed to IntelDeflater)

boolean  false

---

--use-jdk-inflater / -jdk-inflater

Whether to use the JdkInflater (as opposed to IntelInflater)

boolean  false

---

--verbosity / -verbosity

Control verbosity of logging.

The --verbosity argument is an enumerated type (LogLevel), which can have one of the following values:

ERROR

WARNING

INFO

DEBUG

LogLevel  INFO

---

--version / NA

display the version number for this tool

boolean  false

---

Return to top

---

GATK version 4.1.6.0-SNAPSHOT built at Thu, 2 Apr 2020 14:54:17 -0400.