Funcotator – GATK

Functional Annotator

Category Variant Evaluation and Refinement

Overview

Funcotator (FUNCtional annOTATOR) analyzes given variants for their function (as retrieved from a set of data sources) and produces the analysis in a specified output file.

This tool is a functional annotation tool that allows a user to add annotations to called variants based on a set of data sources, each with its own matching criteria.

Detailed Information and Tutorial

Detailed information and a tutorial can be found here:

https://gatkforums.broadinstitute.org/dsde/discussion/11193/funcotator-information-and-tutorial

Data Sources

Data sources are expected to be in folders that are specified as input arguments. While multiple data source folders can be specified, no two data sources can have the same name.

Data Source Folders

In each main data source folder, there should be sub-directories for each individual data source, with further sub-directories for a specific reference (i.e. hg19 or hg38). In the reference-specific data source directory, there is a configuration file detailing information about the data source and how to match it to a variant. This configuration file is required.

An example of a data source directory is the following:

         dataSourcesFolder/
              Data_Source_1/
                  hg19
                      data_source_1.config
                      data_source_1.data.file.one
                      data_source_1.data.file.two
                      data_source_1.data.file.three
                      ...
                   hg38
                      data_source_1.config
                      data_source_1.data.file.one
                      data_source_1.data.file.two
                      data_source_1.data.file.three
                      ...
              Data_Source_2/
                  hg19
                      data_source_2.config
                      data_source_2.data.file.one
                      data_source_2.data.file.two
                      data_source_2.data.file.three
                      ...
                   hg38
                      data_source_2.config
                      data_source_2.data.file.one
                      data_source_2.data.file.two
                      data_source_2.data.file.three
                      ...
               ...

Pre-packaged Data Sources

The GATK includes two sets of pre-packaged data sources, allowing for Funcotator use without (much) additional configuration. These data source packages correspond to the germline and somatic use cases. Broadly speaking, if you have a germline VCF, the germline data sources are what you want to use to start with. Conversely, if you have a somatic VCF, the somatic data sources are what you want to use to start with.
Versioned gzip archives of data source files are provided here:

gnomAD

The pre-packaged data sources include gnomAD, a large database of known variants. gnomAD is split into two parts - one based on exome data, one based on whole genome data. Due to the size of gnomAD, it cannot be included in the data sources package directly. Instead, the configuration data are present and point to a Google bucket in which the gnomAD data reside. This will cause Funcotator to actively connect to that bucket when it is run.
For this reason, gnomAD is disabled by default.
To enable gnomAD, simply change directories to your data sources directory and untar the gnomAD tar.gz files:

         cd DATA_SOURCES_DIR
         tar -zxf gnomAD_exome.tar.gz
         tar -zxf gnomAD_genome.tar.gz

Because Funcotator will query the Internet when gnomAD is enabled, performance will be impacted by the machine's Internet connection speed. If this degradation is significant, you can localize gnomAD to the machine running Funcotator to improve performance (however due to the size of gnomAD this may be impractical).

Data Source Downloader Tool

To improve ease-of-use of Funcotator, there is a tool to download the pre-packaged data sources to the user's machine. This tool is the FuncotatorDataSourceDownloader and can be run to retrieve the pre-packaged data sources from the google bucket and localize them to the machine on which it is run.
Briefly:

For somatic data sources:

 ./gatk FuncotatorDataSourceDownloader --somatic --validate-integrity --extract-after-download

For germline data sources:

 ./gatk FuncotatorDataSourceDownloader --germline --validate-integrity --extract-after-download

Disabling Data Sources

A data source can be disabled by removing the folder containing the configuration file for that source. This can be done on a per-reference basis. If the entire data source should be disabled, the entire top-level data source folder can be removed.

If it is possible that the data source will be re-enabled in the future, then we recommend zipping the data source folder and removing the folder itself, leaving only the zip file in its place. When the time comes to enable data source again, simply unzip the file and the data source will be ready to go the next time Funcotator is run.

User-Defined Data Sources

Users can define their own data sources by creating a new correctly-formatted data source sub-directory in the main data sources folder. In this sub-directory, the user must create an additional folder for the reference for which the data source is valid. If the data source is valid for multiple references, then multiple reference folders should be created. Inside each reference folder, the user should place the file(s) containing the data for the data source. Additionally the user must create a configuration file containing metadata about the data source.

Funcotator allows for data sources with source files that live on the cloud, enabling users to annotate with data sources that are not physically present on the machines running Funcotator.
To create a data source based on the cloud, create a configuration file for that data source and put the cloud URL in as the src_file property (see Configuration File Format for details).
E.g.:

         ...
         src_file = gs://broad-references/hg19/v0/1000G_phase1.snps.high_confidence.b37.vcf.gz
         ...

There are several formats allowed for data sources, however the two most useful are arbitrarily separated value (XSV) files, such as comma-separated value (CSV), tab-separated value (TSV). These files contain a table of data that can be matched to a variant by gene name, transcript ID, or genome position. In the case of gene name and transcript ID, one column must contain the gene name or transcript ID for each row's data.

For gene name, when a variant is annotated with a gene name that exactly matches an entry in the gene name column for a row, that row's other fields will be added as annotations to the variant.
For transcript ID, when a variant is annotated with a transcript ID that exactly matches an entry in the transcript ID column for a row, that row's other fields will be added as annotations to the variant.
For genome position, one column must contain the contig ID, another column must contain the start position (1-based, inclusive), and a column must contain the stop position (1-based, inclusive). The start and stop columns may be the same column. When a variant is annotated with a genome position that overlaps an entry in the three genome position columns for a row, that row's other fields will be added as annotations to the variant.

Configuration File Format

The configuration file is a standard Java properties-style configuration file with key-value pairs. This file name must end in .config.

The following is an example of a genome position XSV configuration file (for the ORegAnno data source):

         name = Oreganno
         version = 20160119
         src_file = oreganno.tsv
         origin_location = http://www.oreganno.org/dump/ORegAnno_Combined_2016.01.19.tsv
         preprocessing_script = getOreganno.py

         # Supported types:
         # simpleXSV    -- Arbitrary separated value table (e.g. CSV), keyed off Gene Name OR Transcript ID
         # locatableXSV -- Arbitrary separated value table (e.g. CSV), keyed off a genome location
         # gencode      -- Custom datasource class for GENCODE
         # cosmic       -- Custom datasource class for COSMIC
         # vcf          -- Custom datasource class for Variant Call Format (VCF) files
         type = locatableXSV

         # Required field for GENCODE files.
         # Path to the FASTA file from which to load the sequences for GENCODE transcripts:
         gencode_fasta_path =

         # Required field for GENCODE files.
         # NCBI build version (either hg19 or hg38):
         ncbi_build_version =

         # Required field for simpleXSV files.
         # Valid values:
         #     GENE_NAME
         #     TRANSCRIPT_ID
         xsv_key =

         # Required field for simpleXSV files.
         # The 0-based index of the column containing the key on which to match
         xsv_key_column =

         # Required field for simpleXSV AND locatableXSV files.
         # The delimiter by which to split the XSV file into columns.
         xsv_delimiter = \t

         # Required field for simpleXSV files.
         # Whether to permissively match the number of columns in the header and data rows
         # Valid values:
         #     true
         #     false
         xsv_permissive_cols = true

         # Required field for locatableXSV files.
         # The 0-based index of the column containing the contig for each row
         contig_column = 1

         # Required field for locatableXSV files.
         # The 0-based index of the column containing the start position for each row
         start_column = 2

         # Required field for locatableXSV files.
         # The 0-based index of the column containing the end position for each row
         end_column = 3

Required Inputs

A reference genome sequence.
The version of the reference genome sequence being used (e.g. hg19, hg38, etc.).
A VCF of variant calls to annotate.
The path to a folder of data sources formatted for use by Funcotator.
The desired output format for the annotated vaiants file (either MAF or VCF)

Output

The basic output of Funcotator is:

A VCF or MAF file containing all variants from the input file with added annotations corresponding to annotations from each data source that matched a given variant according to that data source's matching criteria.

Annotations for Pre-Packaged Data Sources

The pre-packaged data sources will create a set of baseline, or default annotations for an input data set. Most of these data sources copy and paste values from their source files into the output of Funcotator to create annotations. In this sense they are trivial data sources.

Gencode

Funcotator performs some processing on the input data to create the Gencode annotations. Gencode is currently required, so Funcotator will create these annotations for all input variants. The order and a specification of the Gencode annotations that Funcotator creates is as follows:

hugoSymbol
Type: String
The name of the gene in which the annotated variant allele occurs. If the variant allele occurs outside of any known gene boundaries, then this field is set to "Unknown".
ncbiBuild
Type: String
The reference which was used to create this Gencode annotation. Current valid values are: "hg19" or "hg38".
chromosome
Type: String
The contig in which the variant occurs. Will always correspond to the contig in the variant position.
start
Type: Integer
The start position in genomic coordinates of the variant allele being annotated (1-based, inclusive). Will always correspond to the start in the variant position.
end
Type: Integer
The end position in genomic coordinates of the variant allele being annotated (1-based, inclusive). Will always correspond to the position last base in the variant allele.
variantClassification
Type: String
The classification of the variant being annotated. Will always be one of the following:
- COULD_NOT_DETERMINE
  Variant classification could not be determined.
- INTRON
  Variant lies between exons within the bounds of the chosen transcript. Only valid for Introns.
- FIVE_PRIME_UTR
  Variant is on the 5'UTR for the chosen transcript. Only valid for UTRs.
- THREE_PRIME_UTR
  Variant is on the 3'UTR for the chosen transcript Only valid for UTRs.
- IGR
  Intergenic region. Does not overlap any transcript. Only valid for IGRs.
- FIVE_PRIME_FLANK
  The variant is upstream of the chosen transcript Only valid for IGRs.
- THREE_PRIME_FLANK
  The variant is downstream of the chosen transcript Only valid for IGRs.
- MISSENSE
  The point mutation alters the protein structure by one amino acid. Can occur in Coding regions or Introns.
- NONSENSE
  A premature stop codon is created by the variant. Can occur in Coding regions or Introns.
- NONSTOP
  Variant removes stop codon. Can occur in Coding regions or Introns.
- SILENT
  Variant is in coding region of the chosen transcript, but protein structure is identical. Can occur in Coding regions or Introns.
- SPLICE_SITE
  The variant is within a configurable number of bases of a splice site. See the secondary classification to determine if it lies on the exon or intron side. Can occur in Coding regions or Introns.
- IN_FRAME_DEL
  Deletion that keeps the sequence in frame. Can occur in Coding regions or Introns.
- IN_FRAME_INS
  Insertion that keeps the sequence in frame. Can occur in Coding regions or Introns.
- FRAME_SHIFT_INS
  Insertion that moves the coding sequence out of frame. Can occur in Coding regions or Introns.
- FRAME_SHIFT_DEL
  Deletion that moves the sequence out of frame. Can occur in Coding regions or Introns.
- START_CODON_SNP
  Point mutation that overlaps the start codon. Can occur in Coding regions or Introns.
- START_CODON_INS
  Insertion that overlaps the start codon. Can occur in Coding regions or Introns.
- START_CODON_DEL
  Deletion that overlaps the start codon. Can occur in Coding regions or Introns.
- DE_NOVO_START_IN_FRAME
  New start codon is created by the given variant using the chosen transcript. However, it is in frame relative to the coded protein, meaning that if the coding sequence were extended then the new start codon would be in frame with the existing start and stop codons. This can only occur in a 5' UTR.
- DE_NOVO_START_OUT_FRAME
  New start codon is created by the given variant using the chosen transcript. However, it is out of frame relative to the coded protein, meaning that if the coding sequence were extended then the new start codon would NOT be in frame with the existing start and stop codons. This can only occur in a 5' UTR.
- RNA
  Variant lies on one of the RNA transcripts. (special catch-all case)
- LINCRNA
  Variant lies on one of the lincRNAs. (special catch-all case)
secondaryVariantClassification
Type: String
Additional variant classification information for variant alleles that have a variantClassification of SPLICE_SITE. For a variant allele with the variantClassification of SPLICE_SITE, this will indicate the specific classification of the variant. For all variants that do not have the variantClassification of SPLICE_SITE, this will be the empty string.
variantType
Type: String
Basic information about the variant allele being annotated. Can be one of:
- INS - The variant allele is some kind of insertion.
- DEL - The variant allele is some kind of deletion.
- SNP - The variant allele is a single nucleotide polymorphism.
- DNP - The variant allele is a di-nucleotide polymorphism.
- TNP - The variant allele is a tri-nucleotide polymorphism.
- ONP - The variant allele is an oligo-nucleotide polymorphism (Synonymous with MNP).
- MNP - The variant allele is a multi-nucleotide polymorphism (Synonymous with ONP).
- NA - The variant allele type cannot be determined.
refAllele
Type: String
The reference allele for the position at which this this variant allele occurs.
For insertions, this will be set to "-".
tumorSeqAllele1
Type: String
Always the same as the reference allele. This field is a hold-over required for MAF annotations.
For insertions, this will be set to "-".
tumorSeqAllele2
Type: String
The variant allele being annotated. This field only includes the bases that are different from the reference.
For the input VCF records, this field may slightly differ from the alternate allele reported in the base data for the VariantContext.
For deletions, this will be set to "-".
genomeChange
Type: String
A String summarizing the change resulting from this variant allele within the context of the whole genome sequence.
Generally the format of this field is:
```
             g.[CONTIG]:[POSITION][BASES CHANGED]
             
```
The format of this field slightly varies based on VariantType:
- Insertion
```
g.[CONTIG]:[POSITION OF BASE PRIOR TO INSERTION];_[POSITION OF BASE AFTER INSERTION]ins[BASES INSERTED]
```
  E.g.:
```
g.chr19:2018023_2018024insAATCG
```
  This indicates that the bases AATCG were inserted between bases 2018023 and 2018024 on chromosome 19.
- Deletion
```
g.[CONTIG]:[POSITION OF BASE DELETED]del[BASE DELETED]
```
  E.g.:
```
g.chr19:2018023delT
```
  This indicates that the base T was deleted at position 2018023 on chromosome 19. OR
```
g.[CONTIG]:[POSITION OF FIRST BASE DELETED]_[POSITION OF LAST BASE DELETED]del[BASES DELETED]
```
  E.g.:
```
g.chr19:2018023_2018025delTTG
```
  This indicates that the bases TTG were deleted starting at position 2018023 and ending at position 2018025 on chromosome 19.
- SNP
```
g.[CONTIG]:[POSITION OF BASE ALTERED][REFERENCE BASE]>[ALTERNATE BASE]
```
  E.g.:
```
g.chr19:2018023T>G
```
  This indicates that the base T was changed to G at position 2018023 on chromosome 19.
- MNP (including DNPs, TNPs)
```
g.[CONTIG]:[POSITION OF FIRST BASE ALTERED]_[POSITION OF LAST BASE ALTERED][REFERENCE BASES>>[ALTERNATE BASES]
```
  E.g.:
```
g.chr19:2018023_2018025TTG>GAT
```
  This indicates that the bases TTG were changed to GAT from position 2018023 to position 2018025 on chromosome 19.
annotationTranscript
Type: String
The ID of the transcript chosen for the detailed Gencode annotation reporting.
E.g.: ENST00000435064.1
If the variant allele does not occur within the bounds of any transcript (e.g. is of type IGR), then this field is empty.
transcriptStrand
Type: String
The strand direction associated with the transcript on which this variant allele occurs.
Either "+" or "-".
transcriptExon
Type: Integer or Empty
The exon number on the transcript in which this variant allele occurs (1-based). Corresponds directly to the Gencode exon number.
If the variant does not occur in the expressed transcript of the corresponding gene (e.g. is of type INTRON or IGR), then this field is empty.
transcriptPos
Type: Integer or Empty
Position in the chosen transcript of the variant allele. All positions listed are 1-based and inclusive (meaning that the first base in the transcript starts at and ends at position 1).
For variant alleles that occur at a single base, the format is simply the position at which that variant occurs in the transcript (e.g. 1294)
For variant alleles spanning multiple bases, the format is:
```
             [START]_[END]
             
```
E.g.:
```
1236_1237
```
If the variant does not occur in the expressed transcript of the corresponding gene (e.g. is of type INTRON or IGR), then this field is empty.
cDnaChange
Type: String
A String that summarizes the change resulting from this variant allele in the coding sequence for the transcript in which it occurs.
Positions in this field are relative to the start of the transcript (1-based, inclusive) unless otherwise noted.
Generally the format of this field is:
```
             c.[POSITION][BASES CHANGED]
             
```
The format of this field slightly varies based on VariantType, the number of affected bases, and whether the variant allele is a SPLICE_SITE:
- Insertions
```
c.[POSITION OF BASE PRIOR TO INSERTION]_[POSITION OF BASE AFTER INSERTION]ins[BASES INSERTED]
```
  E.g.:
```
c.2018_2019insAA
```
  This indicates that the bases AA were inserted between bases 2018 and 2019 in the transcript associated with this variant allele.
- Deletions of One Base
```
c.[POSITION OF BASE DELETED]del[BASE DELETED]
```
  E.g.:
```
c2018delT
```
  This indicates that the base T was deleted at position 2018 in the transcript associated with this variant allele.
- Deletions of Multiple Bases
```
c.[POSITION OF FIRST BASE DELETED]_[POSITION OF LAST BASE DELETED]del[BASES DELETED]
```
  E.g.:
```
c2018_2022delTTCAG
```
  This indicates that the bases TTCAG were deleted from position 2018 to position 2022 in the transcript associated with this variant allele.
- SNPs
```
c.[POSITION OF BASE CHANGED]>[NEW BASE]
```
  E.g.:
```
c.1507T>G
```
  This indicates that the base T was changed to G at position 1507 in the transcript associated with this variant allele.
- MNPs (including DNPs, TNPs)
```
c.[POSITION OF FIRST BASE CHANGED]_[POSITION OF LAST BASE CHANGED]>[NEW BASES]
```
  E.g.:
```
c.12899_12900AG>TA
```
  This indicates that the bases AG were changed to TA from position 12899 to position 12900 in the transcript associated with this variant allele.
- INTRONIC Variants
  For variants occuring in INTRONs, the cDNA string position indicates the offset from the exon boundary for the start of the variant. The whole string takes the form:
```
c.e[EXON NUMBER][+|-][BASES FROM EXON][REF ALLELE]>[ALT ALLELE]
```
  E.g.:
```
c.e81-4TAA>A
```
  This indicates that the bases TAA were changed to A starting four bases before exon 81 in the transcript associated with this variant allele.
If the variant does not occur in the expressed transcript of the corresponding gene (e.g. is of type IGR), then this field is empty.
codonChange
Type: String
A String that representing the codon-aligned change resulting from this variant allele in the coding sequence for the transcript in which it occurs.
Positions in this field are relative to the start of the transcript (1-based, inclusive) and aligned to the coding sequenceunless otherwise noted.
Unlike the cDnaChange, the bases reported in the codonChange string will always have a length evenly divisble by 3 (except for frameshifts) and represent what the codons would be if the variant alternate allele were expressed in the reference sequence.
Capitalized bases represent the bases changed by the variant alternate allele. Lower-case bases represent reference bases.
Generally the format of this field is:
```
             c.[POSITION][BASES CHANGED]
             
```
The format of this field slightly varies based on VariantType, the number of affected bases, and whether the variant allele occurs in an Intron:
- In-Frame Insertions
```
c.([POSITION OF FIRST BASE IN FIRST CODON IN THE REFERENCE AFFECTED BY THIS VARIANT]-[POSITION OF LAST BASE IN LAST CODON IN THE REFERENCE AFFECTED BY THIS VARIANT][REFERENCE CODONS]>[EXPRESSED CODONS]
```
  E.g.:
```
c.(19-21)ctt>ctCGTt
```
  This indicates that the bases CGT were inserted before the 6th codon (starting at base 19, ending at base 21) in the transcript associated with this variant allele, and the resulting expressed codons would be ctCGTt.
- In-Frame Deletions of Complete Codons (codon-aligned deletions)
```
c.([POSITION OF FIRST BASE IN FIRST CODON DELETED]-[POSITION OF LAST BASE IN LAST CODON DELETED][REFERENCE CODONS]del
```
  E.g.:
```
c.(997-999)gcadel
```
  This indicates that the 332nd codon (starting at base 997, ending at base 999) was deleted in the transcript associated with this variant allele, and the deleted codon bases are gca.
- In-Frame Deletions Spanning Multiple Codons
```
c.([POSITION OF FIRST BASE IN FIRST CODON DELETED]-[POSITION OF LAST BASE IN LAST CODON DELETED][REFERENCE CODONS]>[EXPRESSED CODONS]
```
  E.g.:
```
c.(997-1002)gcactc>gtc
```
  This indicates that bases in the 332nd codon (starting at base 997) and 333rd codon (ending at base 1002) were deleted in the transcript associated with this variant allele, and the resulting expressed codon would be gtc.
- Frame Shift Insertions and Deletions
```
c.([POSITION OF FIRST BASE IN LAST CORRECTLY EXPRESSED/REFERENCE CODON]-[POSITION OF LAST BASE IN LAST CORRECTLY EXPRESSED/REFERENCE CODON][REFERENCE CODONS]>[EXPRESSED CODONS]
```
  E.g.:
```
c.(997-999)gcafs
```
  This indicates that bases just AFTER the 332nd codon (starting at base 997, ending at base 999) were inserted or deleted in the transcript associated with this variant allele resulting in a frame shift, and that the last correctly transcribed codon would be codon 332 (starting at base 997, ending at base 999), 'gca'.
proteinChange
Type: String
A short string representing the predicted amino acid sequence change in the product of the gene transcript in which this variant alternate allele occurs.
Positions in this field are relative to the start of the amino acid sequence (1-based, inclusive) resulting from decoding the codons in the transcript in which this variant alternate allele occursunless otherwise noted.
Amino acid abbreviations are the standard letters as can be found in this table with the exception of the stop codon, which is represented by '*'.
It is important to note that the positions and amino acids reported in this string may not directly align to the codons in which the variant alternate allele occurs. This is most often due to the variant occuring in a set of tandem repeats which would cause the amino acid change to be "pushed" to the end of the tandem repeats.
For protein change strings in the Mitochondrial contig, the mitochondrial genetic code is used (rather than the standard code). The format of this field takes two forms:
- Protein Changes with One Amino Acid Changed
```
p.[REFERENCE AMINO ACID][POSITION][PREDICTED EXPRESSED AMINO ACID]
```
  E.g. 1:
```
p.V5T
```
  The amino acid at protein position 5 was V (Valine) in the reference and would become T (Threonine) with the variant alternate allele expressed.
  E.g. 2:
```
p.R2R
```
  The amino acid at protein position 2 was R (Argenine) in the reference and would become R (Argenine) with the variant alternate allele expressed (no change in amino acid sequence / silent variant classification).
- Protein Changes with Multiple Amino Acids Changed
```
p.[FIRST AFFECTED AMINO ACID POSITION]_[LAST AFFECTED AMINO ACID POSITION][REFERENCE AMINO ACIDS]>[PREDICTED EXPRESSED AMINO ACIDS]
```
  E.g.:
```
p.100_101Q*>FL
```
  The amino acid sequence starting at protein position 100 and ending at protein position 101 was Q* (Glutamine,STOP) in the reference and would become FL (Phenylalanine,Leucine) with the variant alternate allele expressed.
If the variant alternate allele does not occur in a coding region, this field will be empty.
gcContent
Type: Double
Represents the fraction of Guanine and Cytosine bases in a window of a given size around a variant. This window size does not include any bases in the variant alternate allele itself. By default the window size is 200 bases.

referenceContext
Type: String
The strand-correct reference coding sequence in a given window around the reference allele. By default the window size is 10 bases.
E.g. For the reference context around a variant with the reference allele 'C' on the '+' strand:

                      [REF ALLELE]
                           |
                           v
                 GAACCCACGTCGGTGAGGGCC
                 |________| |________|
                     v           v
                  10 bases      10 bases
                (window size)  (window size)

Strand-correct specifically means that if the strand of this transcript is determined to be '-' then the sequence is reverse complemented.
E.g. For the reference context around a variant with the reference allele 'C' on the '-' strand:

                      [REF ALLELE]
                           |
                           v
                 CACGAAAGTCTTGCGGATCT
                 |________| |________|
                     v           v
                  10 bases      10 bases
                (window size)  (window size)

otherTranscripts
Type: String
A summary of the other transcripts in which this variant occurs, which were not chosen for detailed reporting due to the transcript selection scheme.
Each other transcript is represented by a condensed string that indicates how that transcript would be affected by this variant alternate allele.
Each other transcript takes the form:
```
[HUGO SYMBOL]_[TRANSCRIPT ID]_[VARIANT CLASSIFICATION]_[PROTEIN CHANGE STRING]
```
E.g.:
```
SDF4_ENST00000263741.7_MISSENSE_p.R243Q
```
If another transcript were to be an IGR, the other transcript field would be populated with 'IGR_ANNOTATON'
If the other transcript does not have a protein change string, then that part is not rendered.
In the event that there are multiple other transcripts, these transcripts are separated by '/'.
E.g.:
```
SDF4_ENST00000263741.7_MISSENSE_p.R243Q/TNFRSF4_ENST00000379236.3_FIVE_PRIME_FLANK
```
If this variant alternate allele occurs in only one transcript, this field will be empty.

Other annotations will follow the Gencode annotations and will be based on the data sources included in the data sources directory.

Usage example

   ./gatk Funcotator \
   -R reference.fasta \
   -V input.vcf \
   -O outputFile \
   --output-file-format MAF \
   --data-sources-path dataSourcesFolder/ \
   --ref-version hg19

Notes

This tool is the spiritual successor to Oncotator, with better support for germline data, numerous fixes for correctness, and many other features.
REMEMBER: Funcotator is NOT Oncotator.

Known Issues

A complete list of known open issues can be found on the GATK github entry for funcotator here.

Additional Information

Read filters

This Read Filter is automatically applied to the data by the Engine before processing by Funcotator.

WellformedReadFilter

Funcotator specific arguments

This table summarizes the command-line arguments that are specific to this tool. For more details on each argument, see the list further down below the table or click on an argument name to jump directly to that entry in the list.

Argument name(s)	Default value	Summary
Required Arguments
--data-sources-path	[]	The path to a data source folder for Funcotator. May be specified more than once to handle multiple data source folders.
--output -O	null	Output file to which annotated variants should be written.
--output-file-format	null	The output file format. Either VCF, MAF, or SEG. Please note that MAF output for germline use case VCFs is unsupported. SEG will generate two output files: a simple tsv and a gene list.
--ref-version	null	The version of the Human Genome reference to use (e.g. hg19, hg38, etc.). This will correspond to a sub-folder of each data source corresponding to that data source for the given reference.
--reference -R	null	Reference sequence file
--variant -V	null	A VCF file containing variants
Optional Tool Arguments
--annotation-default	[]	Annotations to include in all annotated variants if the annotation is not specified in the data sources (in the format :). This will add the specified annotation to every annotated variant if it is not already present.
--annotation-override	[]	Override values for annotations (in the format :). Replaces existing annotations of the given name with given values.
--arguments_file	[]	read one or more arguments files and add them to the command line
--cloud-index-prefetch-buffer -CIPB	-1	Size of the cloud-only prefetch buffer (in MB; 0 to disable). Defaults to cloudPrefetchBuffer if unset.
--cloud-prefetch-buffer -CPB	40	Size of the cloud-only prefetch buffer (in MB; 0 to disable).
--disable-bam-index-caching -DBIC	false	If true, don't cache bam indexes, this will reduce memory requirements but may harm performance if many intervals are specified. Caching is automatically disabled if there are no intervals specified.
--disable-sequence-dictionary-validation	false	If specified, do not check the sequence dictionaries from our inputs for compatibility. Use at your own risk!
--exclude-field	[]	Fields that should not be rendered in the final output. Only exact name matches will be excluded.
--five-prime-flank-size	5000	Variants within this many bases of the 5' end of a transcript (and not overlapping any part of the transcript itself) will be annotated as being in the 5' flanking region of that transcript
--gcs-max-retries -gcs-retries	20	If the GCS bucket channel errors out, how many times it will attempt to re-initiate the connection
--gcs-project-for-requester-pays	""	Project to bill when accessing "requester pays" buckets. If unset, these buckets cannot be accessed.
--help -h	false	display the help message
--interval-merging-rule -imr	ALL	Interval merging rule for abutting intervals
--intervals -L	[]	One or more genomic intervals over which to operate
--lookahead-cache-bp	100000	Number of base-pairs to cache when querying variants. Can be overridden in individual data source configuration files.
--remove-filtered-variants	false	Ignore/drop variants that have been filtered in the input. These variants will not appear in the output file.
--sites-only-vcf-output	false	If true, don't emit genotype fields when writing vcf file output.
--three-prime-flank-size	0	Variants within this many bases of the 3' end of a transcript (and not overlapping any part of the transcript itself) will be annotated as being in the 3' flanking region of that transcript
--transcript-list	[]	File to use as a list of transcripts (one transcript ID per line, version numbers are ignored) OR A set of transcript IDs to use for annotation to override selected transcript.
--transcript-selection-mode	CANONICAL	Method of detailed transcript selection. This will select the transcript for detailed annotation (CANONICAL, ALL, or BEST_EFFECT).
--version	false	display the version number for this tool
Optional Common Arguments
--add-output-sam-program-record	true	If true, adds a PG tag to created SAM/BAM/CRAM files.
--add-output-vcf-command-line	true	If true, adds a command line header line to created VCF files.
--create-output-bam-index -OBI	true	If true, create a BAM/CRAM index when writing a coordinate-sorted BAM/CRAM file.
--create-output-bam-md5 -OBM	false	If true, create a MD5 digest for any BAM/SAM/CRAM file created
--create-output-variant-index -OVI	true	If true, create a VCF index when writing a coordinate-sorted VCF file.
--create-output-variant-md5 -OVM	false	If true, create a a MD5 digest any VCF file created.
--disable-read-filter -DF	[]	Read filters to be disabled before analysis
--disable-tool-default-read-filters	false	Disable all tool default read filters (WARNING: many tools will not function correctly without their default read filters on)
--exclude-intervals -XL	[]	One or more genomic intervals to exclude from processing
--gatk-config-file	null	A configuration file to use with the GATK.
--input -I	[]	BAM/SAM/CRAM file containing reads
--interval-exclusion-padding -ixp	0	Amount of padding (in bp) to add to each interval you are excluding.
--interval-padding -ip	0	Amount of padding (in bp) to add to each interval you are including.
--interval-set-rule -isr	UNION	Set merging approach to use for combining interval inputs
--lenient -LE	false	Lenient processing of VCF files
--QUIET	false	Whether to suppress job-summary info on System.err.
--read-filter -RF	[]	Read filters to be applied before analysis
--read-index	[]	Indices to use for the read inputs. If specified, an index must be provided for every read input and in the same order as the read inputs. If this argument is not specified, the path to the index for each input will be inferred automatically.
--read-validation-stringency -VS	SILENT	Validation stringency for all SAM/BAM/CRAM/SRA files read by this program. The default stringency value SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded.
--seconds-between-progress-updates	10.0	Output traversal statistics every time this many seconds elapse
--sequence-dictionary	null	Use the given sequence dictionary as the master/canonical sequence dictionary. Must be a .dict file.
--tmp-dir	null	Temp directory to use.
--use-jdk-deflater -jdk-deflater	false	Whether to use the JdkDeflater (as opposed to IntelDeflater)
--use-jdk-inflater -jdk-inflater	false	Whether to use the JdkInflater (as opposed to IntelInflater)
--verbosity	INFO	Control verbosity of logging.
Advanced Arguments
--showHidden	false	display hidden arguments

Argument details

Arguments in this list are specific to this tool. Keep in mind that other arguments are available that are shared with other tools (e.g. command-line GATK arguments); see Inherited arguments above.

--add-output-sam-program-record / -add-output-sam-program-record

If true, adds a PG tag to created SAM/BAM/CRAM files.

boolean true

--add-output-vcf-command-line / -add-output-vcf-command-line

If true, adds a command line header line to created VCF files.

boolean true

--annotation-default / NA

Annotations to include in all annotated variants if the annotation is not specified in the data sources (in the format :). This will add the specified annotation to every annotated variant if it is not already present.

List[String] []

--annotation-override / NA

Override values for annotations (in the format :). Replaces existing annotations of the given name with given values.

List[String] []

--arguments_file / NA

read one or more arguments files and add them to the command line

List[File] []

--cloud-index-prefetch-buffer / -CIPB

Size of the cloud-only prefetch buffer (in MB; 0 to disable). Defaults to cloudPrefetchBuffer if unset.

int -1 [ [ -∞ ∞ ] ]

--cloud-prefetch-buffer / -CPB

Size of the cloud-only prefetch buffer (in MB; 0 to disable).

int 40 [ [ -∞ ∞ ] ]

--create-output-bam-index / -OBI

If true, create a BAM/CRAM index when writing a coordinate-sorted BAM/CRAM file.

boolean true

--create-output-bam-md5 / -OBM

If true, create a MD5 digest for any BAM/SAM/CRAM file created

boolean false

--create-output-variant-index / -OVI

If true, create a VCF index when writing a coordinate-sorted VCF file.

boolean true

--create-output-variant-md5 / -OVM

If true, create a a MD5 digest any VCF file created.

boolean false

--data-sources-path / NA

The path to a data source folder for Funcotator. May be specified more than once to handle multiple data source folders.

R List[String] []

--disable-bam-index-caching / -DBIC

If true, don't cache bam indexes, this will reduce memory requirements but may harm performance if many intervals are specified. Caching is automatically disabled if there are no intervals specified.

boolean false

--disable-read-filter / -DF

Read filters to be disabled before analysis

List[String] []

--disable-sequence-dictionary-validation / -disable-sequence-dictionary-validation

If specified, do not check the sequence dictionaries from our inputs for compatibility. Use at your own risk!

boolean false

--disable-tool-default-read-filters / -disable-tool-default-read-filters

Disable all tool default read filters (WARNING: many tools will not function correctly without their default read filters on)

boolean false

--exclude-field / NA

Fields that should not be rendered in the final output. Only exact name matches will be excluded.

Set[String] []

--exclude-intervals / -XL

One or more genomic intervals to exclude from processing
Use this argument to exclude certain parts of the genome from the analysis (like -L, but the opposite). This argument can be specified multiple times. You can use samtools-style intervals either explicitly on the command line (e.g. -XL 1 or -XL 1:100-200) or by loading in a file containing a list of intervals (e.g. -XL myFile.intervals).

List[String] []

--five-prime-flank-size / NA

Variants within this many bases of the 5' end of a transcript (and not overlapping any part of the transcript itself) will be annotated as being in the 5' flanking region of that transcript

int 5000 [ [ -∞ ∞ ] ]

--gatk-config-file / NA

A configuration file to use with the GATK.

String null

--gcs-max-retries / -gcs-retries

If the GCS bucket channel errors out, how many times it will attempt to re-initiate the connection

int 20 [ [ -∞ ∞ ] ]

--gcs-project-for-requester-pays / NA

Project to bill when accessing "requester pays" buckets. If unset, these buckets cannot be accessed.

String ""

--help / -h

display the help message

boolean false

--input / -I

BAM/SAM/CRAM file containing reads

List[String] []

--interval-exclusion-padding / -ixp

Amount of padding (in bp) to add to each interval you are excluding.
Use this to add padding to the intervals specified using -XL. For example, '-XL 1:100' with a padding value of 20 would turn into '-XL 1:80-120'. This is typically used to add padding around targets when analyzing exomes.

int 0 [ [ -∞ ∞ ] ]

--interval-merging-rule / -imr

Interval merging rule for abutting intervals
By default, the program merges abutting intervals (i.e. intervals that are directly side-by-side but do not actually overlap) into a single continuous interval. However you can change this behavior if you want them to be treated as separate intervals instead.

The --interval-merging-rule argument is an enumerated type (IntervalMergingRule), which can have one of the following values:

ALL
OVERLAPPING_ONLY

IntervalMergingRule ALL

--interval-padding / -ip

Amount of padding (in bp) to add to each interval you are including.
Use this to add padding to the intervals specified using -L. For example, '-L 1:100' with a padding value of 20 would turn into '-L 1:80-120'. This is typically used to add padding around targets when analyzing exomes.

int 0 [ [ -∞ ∞ ] ]

--interval-set-rule / -isr

Set merging approach to use for combining interval inputs
By default, the program will take the UNION of all intervals specified using -L and/or -XL. However, you can change this setting for -L, for example if you want to take the INTERSECTION of the sets instead. E.g. to perform the analysis only on chromosome 1 exomes, you could specify -L exomes.intervals -L 1 --interval-set-rule INTERSECTION. However, it is not possible to modify the merging approach for intervals passed using -XL (they will always be merged using UNION). Note that if you specify both -L and -XL, the -XL interval set will be subtracted from the -L interval set.

The --interval-set-rule argument is an enumerated type (IntervalSetRule), which can have one of the following values:

UNION: Take the union of all intervals
INTERSECTION: Take the intersection of intervals (the subset that overlaps all intervals specified)

IntervalSetRule UNION

--intervals / -L

One or more genomic intervals over which to operate

List[String] []

--lenient / -LE

Lenient processing of VCF files

boolean false

--lookahead-cache-bp / NA

Number of base-pairs to cache when querying variants. Can be overridden in individual data source configuration files.

int 100000 [ [ 0 ∞ ] ]

--output / -O

Output file to which annotated variants should be written.

R File null

--output-file-format / NA

The output file format. Either VCF, MAF, or SEG. Please note that MAF output for germline use case VCFs is unsupported. SEG will generate two output files: a simple tsv and a gene list.

The --output-file-format argument is an enumerated type (OutputFormatType), which can have one of the following values:

VCF
MAF
SEG

R OutputFormatType null

--QUIET / NA

Whether to suppress job-summary info on System.err.

Boolean false

--read-filter / -RF

Read filters to be applied before analysis

List[String] []

--read-index / -read-index

Indices to use for the read inputs. If specified, an index must be provided for every read input and in the same order as the read inputs. If this argument is not specified, the path to the index for each input will be inferred automatically.

List[String] []

--read-validation-stringency / -VS

Validation stringency for all SAM/BAM/CRAM/SRA files read by this program. The default stringency value SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded.

The --read-validation-stringency argument is an enumerated type (ValidationStringency), which can have one of the following values:

STRICT
LENIENT
SILENT

ValidationStringency SILENT

--ref-version / NA

The version of the Human Genome reference to use (e.g. hg19, hg38, etc.). This will correspond to a sub-folder of each data source corresponding to that data source for the given reference.

The --ref-version argument is an enumerated type (FuncotatorReferenceVersion), which can have one of the following values:

hg19
hg38
b37

R FuncotatorReferenceVersion null

--reference / -R

Reference sequence file

R String null

--remove-filtered-variants / NA

Ignore/drop variants that have been filtered in the input. These variants will not appear in the output file.

boolean false

--seconds-between-progress-updates / -seconds-between-progress-updates

Output traversal statistics every time this many seconds elapse

double 10.0 [ [ -∞ ∞ ] ]

--sequence-dictionary / -sequence-dictionary

Use the given sequence dictionary as the master/canonical sequence dictionary. Must be a .dict file.

String null

--showHidden / -showHidden

display hidden arguments

boolean false

--sites-only-vcf-output / NA

If true, don't emit genotype fields when writing vcf file output.

boolean false

--three-prime-flank-size / NA

Variants within this many bases of the 3' end of a transcript (and not overlapping any part of the transcript itself) will be annotated as being in the 3' flanking region of that transcript

int 0 [ [ -∞ ∞ ] ]

--tmp-dir / NA

Temp directory to use.

GATKPathSpecifier null

--transcript-list / NA

File to use as a list of transcripts (one transcript ID per line, version numbers are ignored) OR A set of transcript IDs to use for annotation to override selected transcript.

Set[String] []

--transcript-selection-mode / NA

Method of detailed transcript selection. This will select the transcript for detailed annotation (CANONICAL, ALL, or BEST_EFFECT).

The --transcript-selection-mode argument is an enumerated type (TranscriptSelectionMode), which can have one of the following values:

BEST_EFFECT: BEST_EFFECT Select a transcript to be reported with details with priority on effect according to the folowing list of selection criteria: Choose the transcript that is on the custom list specified by the user. If no list was specified, treat as if no transcripts were on the list (tie). In case of tie, choose the transcript that yields the variant classification highest on the variant classification rank list (see below). If still a tie, choose the transcript with highest level of curation. Note that this means lower number is better for level (see below). If still a tie, choose the transcript with the best appris annotation (see below). If still a tie, choose the transcript with the longest transcript sequence length. If still a tie, choose the first transcript, alphabetically. Levels of Curation: 1 (verified loci) 2 manually annotated loci 3 automatically annotated loci Variant Classification Scores (See {@link org.broadinstitute.hellbender.tools.funcotator.dataSources.gencode.GencodeFuncotation.VariantClassification} as well): De_novo_Start_OutOfFrame 0 Nonsense_Mutation 0 Nonstop_Mutation 0 Missense_Mutation 1 De_novo_Start_InFrame 1 In_Frame_Del 1 In_Frame_Ins 1 Frame_Shift_Del 2 Frame_Shift_Ins 2 Frame_Shift_Sub 2 Start_Codon_SNP 3 Start_Codon_Del 3 Start_Codon_Ins 3 Start_Codon_DNP 3 Start_Codon_TNP 3 Start_Codon_ONP 3 Stop_Codon_SNP 3 Stop_Codon_Del 3 Stop_Codon_Ins 3 Stop_Codon_DNP 3 Stop_Codon_TNP 3 Stop_Codon_ONP 3 Splice_Site 4 Splice_Site_SNP 4 Splice_Site_Del 4 Splice_Site_Ins 4 Splice_Site_DNP 4 Splice_Site_TNP 4 Splice_Site_ONP 4 Splice_Site 4 miRNA 4 Silent 5 3UTR 6 5UTR 6 Intron 7 5Flank 8 3Flank 8 Non-coding_Transcript 9 IGR 20 TX-REF-MISMATCH 100 APPRIS Ranks (http://appris.bioinfo.cnio.es/): appris_principal appris_candidate_highest_score appris_candidate_longest_ccds appris_candidate_ccds appris_candidate_longest_seq appris_candidate_longest appris_candidate no appris tag present
CANONICAL: CANONICAL Select a transcript to be reported with details with priority on canonical order according to the folowing list of selection criteria: Choose the transcript that is on the custom list specified by the user. If no list was specified, treat as if all transcripts were on the list (tie). In case of tie, choose the transcript with highest level of curation. Note that this means lower number is better for level (see below). If still a tie, choose the transcript that yields the variant classification highest on the variant classification rank list (see below). If still a tie, choose the transcript with the best appris annotation (see below). If still a tie, choose the transcript with the longest transcript sequence length. If still a tie, choose the first transcript, alphabetically. Levels of Curation: 1 (verified loci) 2 manually annotated loci 3 automatically annotated loci Variant Classification Scores (See {@link GencodeFuncotation.VariantClassification} as well): De_novo_Start_OutOfFrame 0 Nonsense_Mutation 0 Nonstop_Mutation 0 Missense_Mutation 1 De_novo_Start_InFrame 1 In_Frame_Del 1 In_Frame_Ins 1 Frame_Shift_Del 2 Frame_Shift_Ins 2 Frame_Shift_Sub 2 Start_Codon_SNP 3 Start_Codon_Del 3 Start_Codon_Ins 3 Start_Codon_DNP 3 Start_Codon_TNP 3 Start_Codon_ONP 3 Stop_Codon_SNP 3 Stop_Codon_Del 3 Stop_Codon_Ins 3 Stop_Codon_DNP 3 Stop_Codon_TNP 3 Stop_Codon_ONP 3 Splice_Site 4 Splice_Site_SNP 4 Splice_Site_Del 4 Splice_Site_Ins 4 Splice_Site_DNP 4 Splice_Site_TNP 4 Splice_Site_ONP 4 Splice_Site 4 miRNA 4 Silent 5 3UTR 6 5UTR 6 Intron 7 5Flank 8 3Flank 8 Non-coding_Transcript 9 IGR 20 TX-REF-MISMATCH 100 APPRIS Ranks (http://appris.bioinfo.cnio.es/): appris_principal appris_candidate_highest_score appris_candidate_longest_ccds appris_candidate_ccds appris_candidate_longest_seq appris_candidate_longest appris_candidate no appris tag present
ALL: Same as CANONICAL, but indicates that no transcripts should be dropped. Render all overlapping transcripts.

TranscriptSelectionMode CANONICAL

--use-jdk-deflater / -jdk-deflater

Whether to use the JdkDeflater (as opposed to IntelDeflater)

boolean false

--use-jdk-inflater / -jdk-inflater

Whether to use the JdkInflater (as opposed to IntelInflater)

boolean false

--variant / -V

A VCF file containing variants

R String null

--verbosity / -verbosity

Control verbosity of logging.

The --verbosity argument is an enumerated type (LogLevel), which can have one of the following values:

ERROR
WARNING
INFO
DEBUG

LogLevel INFO

--version / NA

display the version number for this tool

boolean false

Return to top

GATK version 4.1.4.1 built at Thu, 5 Dec 2019 09:51:56 -0500.

6 comments

Edyta Malolepsza

August 17, 2020 23:28
Could you please provide working link to the detailed information and a tutorial? Thank you.
0

Comment actions Permalink
Jonn Smith

November 30, 2021 23:09
Just seeing this now. Here are up-to-date links since I cannot readily edit this article:
- https://gatk.broadinstitute.org/hc/en-us/articles/360035889931-Funcotator-Information-and-Tutorial
- https://gatk.broadinstitute.org/hc/en-us/articles/360035531732-Funcotator-Annotation-Specifications
0

Comment actions Permalink
khushi ahuja

November 02, 2023 15:11
Hello,

I am currently working on estimating tumour mutational burden using the RNA-Mutect-WMN pipeline. The process requires an output from RNA-Mutect, which in turn needs the output of Mutect2.

I have proceeded with the following steps:
1. Acquired tumour RNA-seq fastq files.
2. Executed Mutect2 in tumour-only mode to generate a VCF file.
3. Performed filtering on the VCF and subsequently annotated it using Funcotator (a successor to Oncotator), resulting in MAF files
4. Used the aforementioned MAF file for RNA-Mutect
The initial steps with RNA-Mutect run smoothly, but I encounter issues during the filtering step where MATLAB files come into play. I receive errors related to mismatched column names, and the row numbers do not align as expected. I attempted using other annotators such as VEP and Annovar, but they do not yield the required columns for compatibility.

One possible reason could be I am using funcotator instead of oncotator. Is there a way possible I can still get the access to hg19 database datasource folder for oncotator.

Thank you!
0

Comment actions Permalink
Jonn Smith

November 02, 2023 15:16
Hi khushi ahuja,

Oncotator is no longer supported. There is an hg19 data sources release somewhere for it, but I no longer know where it is hosted. Funcotator uses an older MAF spec, which matches what Oncotator produced, but with better added information.

Please post this as an issue in our github page if you think there is an issue with Funcotator itself. When you post it, please include the version of GATK you are running for Funcotator, the data sources version you're using, and a detailed description of the error (an excerpt of the MAF file would be best so we can see the columns that claim to be mis-matched).

Thanks,

-Jonn
0

Comment actions Permalink
khushi ahuja

November 02, 2023 16:30

Edited
Hello,

Thank you so much for your reply.
Below are the columns that I am getting in the maf file when I am using funcotator

and in the RNA-Mutect github page they have provided with the example maf from oncotator I assume because they have specified to use oncotator for annotation purpose

I can clearly see the difference in the column names being generated in the maf file.
Do you have any suggestions for this.

Thank you so much
0

Comment actions Permalink
Jonn Smith

November 02, 2023 16:34
Please make a new issue in the GATK github with this information.

https://github.com/broadinstitute/gatk
0

Comment actions Permalink

Please sign in to leave a comment.

Genome Analysis Toolkit

Need Help?

Community Forum

Articles in this section

Category Variant Evaluation and Refinement

Overview

Detailed Information and Tutorial

Data Sources

Data Source Folders

Pre-packaged Data Sources

gnomAD

Data Source Downloader Tool

Disabling Data Sources

User-Defined Data Sources

Configuration File Format

Required Inputs

Output

Annotations for Pre-Packaged Data Sources

Gencode

Usage example

Notes

Known Issues

Additional Information

Read filters

Funcotator specific arguments

Argument details

--add-output-sam-program-record / -add-output-sam-program-record

--add-output-vcf-command-line / -add-output-vcf-command-line

--annotation-default / NA

--annotation-override / NA

--arguments_file / NA

--cloud-index-prefetch-buffer / -CIPB

--cloud-prefetch-buffer / -CPB

--create-output-bam-index / -OBI

--create-output-bam-md5 / -OBM

--create-output-variant-index / -OVI

--create-output-variant-md5 / -OVM

--data-sources-path / NA

--disable-bam-index-caching / -DBIC

--disable-read-filter / -DF

--disable-sequence-dictionary-validation / -disable-sequence-dictionary-validation

--disable-tool-default-read-filters / -disable-tool-default-read-filters

--exclude-field / NA

--exclude-intervals / -XL

--five-prime-flank-size / NA

--gatk-config-file / NA

--gcs-max-retries / -gcs-retries

--gcs-project-for-requester-pays / NA

--help / -h

--input / -I

--interval-exclusion-padding / -ixp

--interval-merging-rule / -imr

--interval-padding / -ip

--interval-set-rule / -isr

--intervals / -L

--lenient / -LE

--lookahead-cache-bp / NA

--output / -O

--output-file-format / NA

--QUIET / NA

--read-filter / -RF

--read-index / -read-index

--read-validation-stringency / -VS

--ref-version / NA

--reference / -R

--remove-filtered-variants / NA

--seconds-between-progress-updates / -seconds-between-progress-updates

--sequence-dictionary / -sequence-dictionary

--showHidden / -showHidden

--sites-only-vcf-output / NA

--three-prime-flank-size / NA

--tmp-dir / NA

--transcript-list / NA

--transcript-selection-mode / NA

--use-jdk-deflater / -jdk-deflater

--use-jdk-inflater / -jdk-inflater

--variant / -V

--verbosity / -verbosity

--version / NA

Related articles