Genome Analysis Toolkit

Variant Discovery in High-Throughput Sequencing Data

GATK process banner

Need Help?

Search our documentation

Community Forum

Hi, How can we help?

Developed in the Data Sciences Platform at the Broad Institute, the toolkit offers a wide variety of tools with a primary focus on variant discovery and genotyping. Its powerful processing engine and high-performance computing features make it capable of taking on projects of any size. Learn more

Spanning or overlapping deletions (* allele) Follow

1 comment

  • Avatar
    Joanna Kelley

    I am getting an error with Genome Analysis Toolkit (GATK) v4.1.4.1

    htsjdk.tribble.TribbleException: The provided VCF file is malformed at approximately line number 78746: unparsable vcf record with allele *CCCCCCCCCGCCCCTCCCCC, for input source: test.vcf.gz

    How can I solve this error? The start of the line of the vcf is 

    NC_036443.1 78983 . ACCCCCCCCCCCCCCCCCCCGCCCCTCCCCC ACCCCCCCCCGCCCCTCCCCC,*CCCCCCCCCGCCCCTCCCCC,ACCCCCCCGCCCCTCCCCC,*

    0
    Comment actions Permalink

Please sign in to leave a comment.

Powered by Zendesk